微信小陈
微信小章| 产品名称： | Gloeophyllum trabeum (Persoon : Fries) Karsten |
|---|---|
| 商品货号： | TS133699 |
| Deposited As： | Lenzites trabea Persoon : Fries |
| Strain Designations： | Madison 617 ATCC 12678, ATCC 46150, CSIRO DFP 2365, CSIRO DFP 7520, FP-39264, WFPL 47L |
| Application： | Fungus resistance testing wood
Produces Fenton reagent
Produces NADPH:quinone reductase quinone oxidoreductase
Produces endoglucanase
Produces glucanase
Produces glycosidase
Testing wood preservatives |
| Biosafety Level： | 1
Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country. |
| Product Format： | frozen |
| Storage Conditions： | Frozen: -80°C or colder Freeze-Dried: 2°C to 8°C Live Culture: See Propagation Section |
| Type Strain： | no |
| Preceptrol®： | no |
| Genome Sequenced Strain： | Yes |
| Comments： | Colorimetric analysis of degraded wood
Genome sequencing strain (the Joint Genome Institute at the Department of Energy, USA). |
| Medium： | ATCC® Medium 337: Potato, dextrose, yeast agar (PDY) ATCC® Medium 336: Potato dextrose agar (PDA) ATCC® Medium 325: Malt extract agar (Blakeslees formula) |
| Growth Conditions： | Temperature: 24°C to 26°C
Atmosphere: Typical aerobic |
| Sequenced Data： |
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence
GGTTTCCGTAGGTGAACCTGCGGAAGGATCATTAACGAGTAAACAGGGGAGTTGTAGCTGGCCGCAAGGCATGTGCACGCTCCCTACTCAATCCCACCTTACACCTGTGCATCTATTGTAGGTCGGGTGGCTTGGCTCCATGTCAGGCTGTCCTTCCTATGTCTACACATACACTTTGTAGTTTCAGAATGTAAACTGCGTATAACGCATCTATAAACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCACTCCTTGGTATTCCGAGGAGTATGCCTGTTTGAGTGTCATGAATATCTCAACTCACCCGGTTTTTGTAAATTGTGGTGGGCTTGGACTTGGAGGTATGCTGGTTTTACTAGTCGGCTCCTCTTTAAATGTATTAGCTGGACCCGTTACGGATCAGTACTCGGTGTGATAATTGTCTACGCCGTGTCTGTGAAGTGCCTTAGTGGATCAGCTGCTAATCGTCTTCGGACAATTTGACATTTTGACCTCAAATCAGGTAGGATTACCTGCTGAACTTAAGCATATCAATAA D1D2 region of the 28S ribosomal RNA gene ATATCAATAAGCGGAGGAAAAGAAACTAACAAGGATTCCCCTAGTAACTGCGAGTGAAGCGGGAAGAGCTCAAATTTAAAATCTGGCGGTCTTTGGCCGTCCGAGTTGTATTCTGGAGAAGTGCTTTCCGCGCTGGACCGTGTATAAGTCTCTTGGAACAGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAGTGCTTTGTGATGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACGCTTGAAGTCAGTCGCGTTGGCCGGGACTCAGCCTTGCCTTCCGCTTGGTGTATTTTCCGGTCGACGGGCCAACATCGATTTTGACTGCTGGACAAGGGCTAGTGGAATGTGGCACCCTCGGGTGTGTTATAGCCGCTAGTCATATACAGCAGACGGGATCGAGGACCGCAGCTTCGGCTTAGGATGTTGGCATAATGGCTTTAAACGAC |
| Name of Depositor： | FF Lombard |
| Isolation： | Sporophore on western red cedar pole |
| Cross References： | Nucleotide (GenBank) : KU729035 ITS including 5.8S rRNA gene Nucleotide (GenBank) : KU729119 D1/D2 region of 28S rRNA gene Nucleotide (GenBank) : AFVP00000000 Gloeophyllum trabeum TS133699, whole genome shotgun sequencing project |
| References： | Highley TL, Micales JA. Effect of aromatic monomers on production of carbohydrate-degrading enzymes by white-rot and brown-rot fungi. FEMS Microbiol. Lett. 66: 15-22, 1990. Blankenhorn PH, Balgwin RC, Ottone DP. Calorific analysis of fungal degraded wood. Wood Sci. 13: 26-31, 1980. Cotoras M, Agosin E. Regulatory aspects of endoglucanase production by the brown-rot fungus Gloeophyllum trabeum. Exp. Mycol. 16: 253-260, 1992. ASTM International Standard Test Method for Wood Preservatives by Laboratory Soil-block Cultures. West Conshohocken, PA:ASTM International;ASTM Standard Test Method D 1413-07. ASTM International Standard Test Method of Accelerated Laboratory Test of Natural Decay Resistance of Woods. West Conshohocken, PA:ASTM International;ASTM Standard Test Method D 2017-05. AWPA Standard method of testing wood preservatives by laboratory soil-block cultures. Birmingham, AL: American Wood-Preservers Association; AWPA E10-06, 2006 Da Costa EW. Comparative decay resistance of Australian timbers in accelerated laboratory tests. Aust. For. Res. 9: 119-135, 1979. Jensen KA Jr., et al. Pathways for extracellular Fenton chemistry in the brown rot basidiomycete Gloeophyllum trabeum. Appl. Environ. Microbiol. 67: 2705-2711, 2001. PubMed: 11375184 Smith RS. Proposed standard method of testing wood preservatives by soil-block cultures and respiration analysis. Proc. Am. Wood Preserv. Assoc. 72: 222-229, 1976. Butcher JA, Preston AF. Toxicity of tertiary amine acetates against basidiomycetes and soft-rot fungi. N.Z. J. For. Sci. 8: 397-402, 1978. Behr EA. Effect of pre-wetting of particle board in laboratory decay tests. Int. Biodeterior. Bull. 13: 9-11, 1977. Jensen KA Jr, et al. An NADH:quinone oxidoreductase active during biodegradation by the brown-rot basidiomycete Gloeophyllum trabeum. Appl. Environ. Microbiol. 68: 2699-2703, 2002. PubMed: 12039722 Standard accelerated laboratory method for testing the efficacy of preservatives against wood decay fungi using compression strength. Birmingham, AL: American Wood-Preservers Association; AWPA E22-06, 2006 Sydenham R, et al. Cloning and enzymatic characterization of four thermostable fungal endo-1,4-beta-xylanases. Appl. Microbiol. Biotechnol. 98: 3613-3628, 2014. PubMed: 24085392 Floudas D, et al. The Paleozoic origin of enzymatic lignin decomposition reconstructed from 31 fungal genomes. Science 336: 1715-1719, 2012. PubMed: 22745431 Tambor JH, et al. Recombinant expression, activity screening and functional characterization identifies three novel endo-1,4-beta-glucanases that efficiently hydrolyse cellulosic substrates. Appl. Microbiol. Biotechnol. 93: 203-214, 2012. PubMed: 21710260 Ryu JS, et al. Proteomic and functional analysis of the cellulase system expressed by Postia placenta during brown rot of solid wood. Appl. Environ. Microbiol. 77: 7933-7941, 2011. PubMed: 21948841 Cohen R, Suzuki MR, Hammel KE. Differential stress-induced regulation of two quinone reductases in the brown rot basidiomycete Gloeophyllum trabeum. Appl. Environ. Microbiol. 70: 324-331, 2004. PubMed: 14711659 |