微信小陈
微信小章| 产品名称： | Phanerochaete chrysosporium Burdsall |
|---|---|
| 商品货号： | TS134785 |
| Strain Designations： | VKMF-1767 OGC 101 |
| Alternate State： | Sporotrichum pulverulentum Novobranova, Sporotrichum pruinosum Gilman et Abbott |
| Application： | Degrades 2,4,6-trinitrotoluene TNT
Degrades Congo red Congo Red
Degrades azure B Azure B
Degrades lignin
Degrades metolachlor
Degrades orange II Orange II
Degrades tropaeolin O
Produces 1,4-benzoquinone
Produces glucosidase, beta; acid Glucosidase, beta, acid, glucocerebrosidase
Degradesxa0lignin in deinked pulp
Producesxa0cellulose-binding beta-glucosidase |
| Biosafety Level： | 1
Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country. |
| Product Format： | freeze-dried |
| Storage Conditions： | Frozen: -80°C or colder Freeze-Dried: 2°C to 8°C Live Culture: See Propagation Section |
| Type Strain： | no |
| Disclosure： | This material is cited in a US or other Patent and may not be used to infringe the claims. Depending on the wishes of the Depositor, ATCC may be required to inform the Patent Depositor of the party to which the material was furnished. This material may not have been produced or characterized by ATCC. |
| Preceptrol®： | no |
| Genome Sequenced Strain： | Yes |
| Comments： | Genome sequencing strain (National Institute of Forest Science, South Korea) |
| Medium： | ATCC® Medium 312: Czapeks agar ATCC® Medium 323: Malt agar medium ATCC® Medium 336: Potato dextrose agar (PDA) |
| Growth Conditions： | Temperature: 24°C to 26°C Atmosphere: Typical aerobic |
| Sequenced Data： | 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence.
TTGTAGCTGGCCTCTCGGGGCATGTGCACGCCTGGCTCATCCACTCTTCAACCTCTGTGCACTTGTTGTAGGTCGGTAGAAGAGCGAGCATCCTCTGATGCTTTGCTTGGAAGCCTTCCTATGTTTTACTACAAACGCTTCAGTTTAAGAATGTCTACCTGCGTACAACGCATCTATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCCTGGTATTCCGGGGAGCATGCCTGTTTGAGTGTCATGGTATCCTCAACCTTCATAACTTTTTGGTATCCAAAGGTTGGACTTGGAAGGTGGGGTGGGTTCCAATCCAAGCCGGTCCTCCTAAATGGTTTAACGGGAGTGGTACCGAACCCTTCCGTGGGGATATTAACTGGCCCCGGGTCCTGAAATAACCTTAGCTTGGCCTTCCTAACCGCCTTCCATTGGAACAACTAACTTGACCTCCGAACTTCAAACCAGGTAGACTACCCGCTTAAACTTAGCATTACCATAGGCCGAAGAAAGCCCCGGGCCACCCCCCTTCACCCC |
| Name of Depositor： | Genex Corp. |
| U.S. Patent Number： | |
| Isolation： | Wood chip pile, USSR |
| Cross References： | Nucleotide (GenBank) : MJGA00000000 Phanerochaete chrysosporium strain TS134785, whole genome shotgun sequencing project |
| References： | Ma B, et al. Novel promoter sequence required for manganese regulation of manganese peroxidase isozyme 1 gene expression in Phanerochaete chrysosporium. Eukaryot Cell 3: 579-588, 2004. PubMed: 15189980 Ma B, Mayfield MB, Gold MH. The green fluorescent protein gene functions as a reporter of gene expression in Phanerochaete chrysosporium. Appl Environ Microbiol 67: 948-955, 2001. PubMed: 11157267 Reddy GV, Gold MH. Degradation of pentachlorophenol by Phanaerochaete chrysosporium: intermediates and reactions involved. Microbiology 146: 405-413, 2000. PubMed: 10708379 Akileswaran L, et al. 1,4-benzoquinone reductase from Phanerochaete chrysosporium: cDNA cloning and regulation of expression. Appl Environ Microbiol 65: 415-421, 1999. PubMed: 9925562 Gettemy JM, et al. Reverse transcription-PCR analysis of the regulation of the manganese peroxidase gene family. Appl. Environ. Microbiol. 64: 569-574, 1998. PubMed: 9464395 Li B, Renganathan V. Gene cloning and characterization of a novel cellulose-binding beta-glucosidase from Phanerochaete chrysosporium. Appl Environ Microbiol 64: 2748-2754, 1998. PubMed: 9647863 Gettemy JM, et al. Truncated-gene reporter system for studying the regulation of manganese peroxidase expression. Curr. Genet. 31: 519-524, 1997. PubMed: 9211796 Alic M, Akileswaran L, Gold MH. Characterization of the gene encoding manganese peroxidase isozyme 3 from Phanerochaete chrysosporium. Biochim Biophys Acta 1338: 1-7, 1997. PubMed: 9074609 Li B, Nagalla SR, Renganathan V. Cellobiose dehydrogenase from Phanerochaete chrysosporium is encoded by two allelic variants. Appl Environ Microbiol 63: 796-799, 1997. PubMed: 9023960 Li B, Nagalla SR, Renganathan V. Cloning of a cDNA encoding cellobiose dehydrogenase, a hemoflavoenzyme from Phanerochaete chrysosporium. Appl Environ Microbiol 62: 1329-1335, 1996. PubMed: 8919793 Pacepavicius GJ, et al. Assessment of cyanazine persistence in water. Environ. Toxicol. Water Qual. 11: 27-36, 1996. Brock BJ, et al. Purification and characterization of a 1,4-benzoquione reductase from the basidiomycete Phanerochaete chrysosporium. Appl. Environ. Microbiol. 61: 3076-3081, 1995. Lymar ES, et al. Purification and characterization of a cellulose-binding beta-glucosidase from cellulose-degrading cultures of Phanerochaete chrysosporium. Appl. Environ. Microbiol. 61: 2976-2980, 1995. Liu D, et al. Microbial transformation of metolachlor. Environ. Toxicol. Water Qual. 10: 249-258, 1995. Fukui H, et al. Improved conditions for biodelignification of deinked pulp by enzymes from Phanerochaete chrysosporium. Cellul. Chem. Technol. 26: 701-711, 1992. Lebron CA, et al. Biodegradation of 2,4,6-trinitrotoluene by white-rot fungus. US Patent 5,085,998 dated Feb 4 1992 Cripps C, et al. Biodegradation of azo and heterocyclic dyes by Phanerochaete chrysosporium. Appl. Microbiol. 56: 1114-1118, 1990. PubMed: 2339873 |