产品名称: | Fusarium oxysporum Schlechtendahl |
---|---|
商品货号: | TS136203 |
Deposited As: | Fusarium stilboides Wollenweber |
Strain Designations: | MU 1007 |
Biosafety Level: | 1
Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country. |
Product Format: | freeze-dried |
Storage Conditions: | Frozen: -80°C or colder Freeze-Dried: 2°C to 8°C Live Culture: See Propagation Section |
Type Strain: | no |
Preceptrol®: | no |
Comments: | For better sporulation, incubate under black light. |
Medium: | ATCC® Medium 200: YM agar or YM broth ATCC® Medium 336: Potato dextrose agar (PDA) ATCC® Medium 338: Potato sucrose agar |
Growth Conditions: | Temperature: 24°C toxa026°C
Atmosphere: Typical aerobic
Note: For better sporulation, incubate under black light. |
Sequenced Data: |
18S ribosomal RNA gene, partial sequence; internalxa0xa0 transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence
GGTCTCCGTTGGTGAACCAGCGGAGGGATCATTACCGAGTTTACAACTCCCAAACCCCTGTGAACATACCACTTGTTGCCTCGGCGGATCAGCCCGCTCCCGGTAAAACGGGACGGCCCGCCAGAGGACCCCTAAACTCTGTTTCTATATGTAACTTCTGAGTAAAACCATAAATAAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCAAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGTATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCACAGCTTGGTGTTGGGACTCGCGTTAATTCGCGTTCCTCAAATTGATTGGCGGTCACGTCGAGCTTCCATAGCGTAGTAGTAAAACCCTCGTTACTGGTAATCGTCGCGGCCACGCCGTTAAACCCCAACTTCTGAATGTTGACCTCGGATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAA |
Name of Depositor: | M Baxter |
Chain of Custody: | ATCC <-- M Baxter<-- H.M. Hussein |
Isolation: | Maize field soil, New Zealand |