
产品名称: | Yarrowia lipolytica (Wickerham et al.) van der Walt et von Arx |
---|---|
商品货号: | TS136734 |
Deposited As: | Yarrowia lipolytica (Wickerham et al.) van der Walt et von Arx, teleomorph |
Strain Designations: | D.1805 |
Synonym: | Endomycopsis lipolytica Wickerham et al., Saccharomycopsis lipolytica (Wickerham et al.) Yarrow |
Alternate State: | Candida lipolytica (Harrison) Diddens et Lodder |
Application: | Produces citric acid citrate |
Biosafety Level: | 1
Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country. |
Product Format: | freeze-dried |
Storage Conditions: | Frozen: -80°C or colder Freeze-Dried: 2°C to 8°C Live Culture: See Propagation Section |
Type Strain: | no |
Disclosure: | This material is cited in a US or other Patent and may not be used to infringe the claims. Depending on the wishes of the Depositor, ATCC may be required to inform the Patent Depositor of the party to which the material was furnished. This material may not have been produced or characterized by ATCC. |
Preceptrol®: | no |
Comments: | Self-cycling fermentation |
Morphology: | After 7 days on YM medium at 25°C, colonies are off white, soft and dull. Slant growth is wrinkled and butyrous. Cells are ovoid to elongate in singles, pairs and clusters. Pseudohyphae are present. |
Medium: | ATCC® Medium 200: YM agar or YM broth |
Growth Conditions: | Temperature: 24°C to 26°C
Atmosphere: Typical aerobic |
Sequenced Data: |
D1D2 region of the 26S ribosomal RNA gene GCCTCAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAACCCTCGGGATTGTAATTTGAAGATTTGGCATTGGAGAAAGCTAACCCAAGTTGCTTGGAATAGTACGTCATAGAGGGTGACAACCCCGTCTGGCTAACCGTTCTCCATGTATTGCCTTATCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAGTGGGTGGTAAACTCCATCTAAAGCTAAATACTGGTGAGAGACCGATAGCGAACAAGTACTGTGAAGGAAAGGTGAAAAGAACTTTGAAAAGAGAGTGAAATAGTATGTGAAATTGTTGATAGGGAAGGAAATGAGTGGAGAGTGGCCGAGGTTTCAGCCGCCCCTCGTGGGCGGTGTACTGCCGACGCCGAGTCATCGATAGCGAGACGAGGGTTACAAATGGGAGCGCCTTTCGGGCGT |
Name of Depositor: | P Maldonado |
U.S. Patent Number: | |
Chain of Custody: | ATCC <-- P Maldonado <-- C Gaillardin (Endomycopsis lipolytica) |
Isolation: | Nonsporulating diploid |
References: | Maldonado P, Charpentier M. Fermentation process for the production of citric and isocitric acids. US Patent 3,997,399 dated Dec 14 1976 Wentworth SD, Cooper DG. Self-cycling fermentation of a citric acid producing strain of Candida lipolytica. J. Ferment. Bioeng. 81: 400-405, 1996. French Patent 72/41 913 Briffaud J, Engasser JM. Citric acid production from glucose. I. Growth and excretion kinetics in a stirred fermentor. Biotechnol. Bioeng. 21: 2083-2092, 1979. Briffaud J, Engasser JM. Citric acid production from glucose. II. Growth and excretion kinetics in a trickle-flow fermentor. Biotechnol. Bioeng. 21: 2093-2111, 1979. |