微信小陈
微信小章| 产品名称： | Trichophyton rubrum (Castellani) Sabouraud |
|---|---|
| 商品货号： | TS140646 |
| Strain Designations： | MRL 666 |
| Application： | Susceptibility testing
Antifungal susceptibility testing Ref
  Ghannoum MA, et al. Interlaboratory study of quality control isolates for a broth microdilution method (modified CLSI M38-A) for testing susceptibilities of dermatophytes to antifungals. J. Clin. Microbiol. 44: 4353-4356, 2006. RefEspinel-Ingroff A, et al. Quality control and reference guidelines for CLSI broth microdilution susceptibility method (M38-A document) for amphotericin B, itraconazole, posaconazole, and voriconazole. J. Clin. Microbiol. 43: 5243-5246, 2005.Biomedical Research and Development Material |
| Biosafety Level： | 2
Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country. |
| Product Format： | frozen |
| Storage Conditions： | Frozen: -80°C or colder Freeze-Dried: 2°C to 8°C Live Culture: See Propagation Section |
| Type Strain： | no |
| Preceptrol®： | no |
| Comments： | Keratinophilic dermatophyte
The most common cause of athletes foot
This organism is a CLSI control strain for antimicrobial susceptibility testing. |
| Morphology： | After 4-5 days on Potato dextrose agar at 25°C colonies fluffy to cottony white, reverse yellow then turn to wine-red. Microconidia are clavate to pyriform, sessile alongside undifferentiated hyphae. |
| Medium： | ATCC® Medium 336: Potato dextrose agar (PDA) ATCC® Medium 200: YM agar or YM broth ATCC® Medium 28: Emmons modification of Sabourauds agar |
| Growth Conditions： | Temperature: 25°C to 30°C
Atmosphere: Typical aerobic |
| Sequenced Data： |
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence
GGTTTCCGTAGGTGAACCTGCGGAAGGATCATTAACGCGCAGGCCGGAGGCTGGCCCCCCACGATAGGGACCGACGTTCCATCAGGGGTGAGCAGACGTGCGCCGGCCGTACGCCCCCATTCTTGTCTACCTCACCCGGTTGCCTCGGCGGGCCGCGCTCCCCCTGCCAGGGAGAGCCGTCCGGCGGGCCCCTTCTGGGAGCCTCGAGCCGGACCGCGCCCGCCGGAGGACAGACACCAAGAAAAAATTCTCTGAAGAGCTGTCAGTCTGAGCGTTTAGCAAGCACAATCAGTTAAAACTTTCAACAACGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTCTGGCATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCAACCCCTCAAGCCCGGCTTGTGTGATGGACGACCGTCCGGCCCCTCCCTTCGGGGGCGGGACGCGCCCGAAAAGCAGTGGCCAGGCCGCGATTCCGGCTTCCTAGGCGAATGGGCAGCCAATTCAGCGCCCTCAGGACCGGCCGCCCTGGCCCCAATCTTTATATATATATATATCTTTTCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAA D1D2 region of the 28S ribosomal RNA gene ATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGGCAAGAGCTCAAATTTGAAATCTGGCCTCCCCCGGGGGTCCGAGTTGTAATTTGCAGAGGATGCTTCGGGCGCGGCCCCCGTCTAAGTTCCTTGGAACAGGACGTCAGAGAGGGTGAGAATCCCGTCTTGGGCGGGCGGCCCGCGCCCGTGTGAAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGCGGGTGGTAAATTTCATCTAAAGCTAAATACCGGCCGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGGTTAAAAGCACCTTGAAAAGGGAGTTAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCGGCCAGACTCGGGGGGCGGGGTTCAGCGGGCGCTCGTCGCCCGTGCACTGCCCGCTCCCCGGGCCAGCATCAGCTTCGACGGCCGGTCAAAGGCCCCCGGAATGTGTCGTCTCTAGGGACGTCTTATAGCCGGGGGTGCAATGCGGCCCGTCGAGACTGAGGAACGCGCTCCGGCTCGGATGCTGGCGTAATGGCCGTAAGCGGC |
| Name of Depositor： | MA Ghannoum |
| Special Collection： | ATCC |
| Chain of Custody： | ATCC |
| Isolation： | Human toenail, USA |
| Cross References： | Nucleotide (GenBank) : KU729196 D1/D2 region of 28S rRNA gene Nucleotide (GenBank) : FJ746657 ITS including 5.8S rRNA gene |
| References： | Reference Method for Broth Dilution Antifungal Susceptibility Testing of Filamentous Fungi; Approved Standard. Wayne, PA. Clinical and Laboratory Standards Institute; CLSI M38-A. Reference Method for Broth Dilution Antifungal Susceptibility Testing of Filamentous Fungi: Approved Standard - 2nd Edition. Wayne, PA. Clinical and Laboratory Standards Institute; CLSI M38-A2. Ghannoum MA, et al. Interlaboratory study of quality control isolates for a broth microdilution method (modified CLSI M38-A) for testing susceptibilities of dermatophytes to antifungals. J. Clin. Microbiol. 44: 4353-4356, 2006. Shehata AS, et al. Comparison between the standardized Clinical and Laboratory Standards Institute M38-A2 method and a 2,3-bis(2-methoxy-4-nitro-5-(sulphenylamino)carbonyl-2H-tetrazolium hydroxide- based method for testing antifungal susceptibility of dermatophytes. J. Clin. Microbiol. 46: 3668-3671, 2008. Espinel-Ingroff A, et al. Quality control and reference guidelines for CLSI broth microdilution susceptibility method (M38-A document) for amphotericin B, itraconazole, posaconazole, and voriconazole. J. Clin. Microbiol. 43: 5243-5246, 2005. Ghannoum M, et al. Multilaboratory evaluation of in vitro antifungal susceptibility testing of dermatophytes for ME1111. J. Clin. Microbiol. 2015 Dec 30. pii: JCM.03019-15. Epub ahead of print PubMed: 26719434 |