产品名称: | Metschnikowia noctiluminum Nguyen et al. |
---|---|
商品货号: | TS141086 |
Strain Designations: | IY 03-8-14-2-2-1 CBS 9907, NRRL Y-27753 |
Biosafety Level: | 1
Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country. |
Product Format: | frozen |
Type Strain: | yes |
Preceptrol®: | no |
Comments: | Insect associated yeast. Isolated from digestive tract of lacewing. |
Medium: | ATCC® Medium 200: YM agar or YM broth |
Growth Conditions: | Temperature: 20.0-25.0°C
|
Sequenced Data: | >ITS DNA sequence for MYA-4342
TTTCCGTAGGTGAACCTGCGGAAGGATCATTAAAAAAAAATTATTATACATCTCTTCTAGGATTAAACACTAAATGTTATATATTTCAACAAGTTTTAAAAATAAAAAAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAATTGCGATACGTAATATGACTTGCAGACGTGAATCATTGAATTTTTGAACGCACATTGCGCCTTAAGGTATTCCTCAAGGCATGCGTGAATGAGCGATATTTACTCTCAAACCCCTAGGGTTTGGTCCTGGCCCCCTACAGCCTAAACATCAACTGATTTTAAAATAAGTTTTAATCTCATCCCCCTTATTTCCTCATTTTCGTAAGACTACCCGCTGAACTTAAG |
Name of Depositor: | SO Suh |
Special Collection: | ATCC |
Chain of Custody: | ATCC |
Isolation: | Gut of Ceraeochrysa lineaticornis (Chrysopidae), Walker, LA, USA. |
Cross References: | Nucleotide (GenBank) : FJ614678 D1/D2 region of 28S rRNA gene Nucleotide (GenBank) : FJ810507 ITS including 5.8S rRNA gene |
References: | Nguyen, N.H. et al. Metschnikowia noctiluminum sp. nov., Metschnikowia corniflorae sp. nov., and Candida chrysomelidae sp. nov., isolated from green lacewings, and beetles. Mycological Research 110: 346-356, 2006. |