| 产品名称: | Heterobasidion irregulare Garbelotto et Otrosina |
|---|---|
| 商品货号: | TS141569 |
| Strain Designations: | TC 32-1 |
| Biosafety Level: | 1
Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country. |
| Product Format: | frozen |
| Storage Conditions: | Frozen: -80°C or colder Freeze-Dried: 2°C to 8°C Live Culture: See Propagation Section |
| Type Strain: | no |
| Preceptrol®: | no |
| Genome Sequenced Strain: | Yes |
| Comments: | Plant pathogen. Genome sequencing strain (the Joint Genome Institute at the Department of Energy, USA). The strain has been also known as Heterobasidion annosum. |
| Morphology: | On MD-336 after 7 days at 25°C, colonies are white to off-white; produces cream to light yellow colored conidiospores. |
| Medium: | ATCC® Medium 200: YM agar or YM broth ATCC® Medium 336: Potato dextrose agar (PDA) |
| Growth Conditions: | Temperature: 24°C to
26°C
Atmosphere: Typical aerobic |
| Sequenced Data: |
ITS sequence of MYA-4689
GGTTTCCGTAGGTGAACCTGCGGAAGGATCATTAACGAATATCGTGCAAGGTTGAAGCTGGCCTCTCGGGGCATGTGCTCGCCTTGTTCATATCCATCTCACACCTGTGCACACTCGCGTGGGTCGGTCGGGTTCTTTTGATCCCTTCCGAGCCGCGTCTTCTCACAAATCCTTCGTATGTCTTCAGAATGGTATCAATGCTATAAAACGCATCTTATACAACTTTCAACAATGGATCTCTCGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCTTTGGTATTCCGAAGGGCACGCCTGTTTGAGTGTCGTGAAATTCTCAACCCCGTGCTTTTCTTGTGAAAGCGCGTGGGCTTGGACTTGGAGGTTTTGCTGGTCCTCGCGGATCGGCTCCTCTCAAATGCATTAGCGAGACCCTTGTGGTGCCGTCCCCGGTGTGATAATTGTCTACGCCGTGGGGTACGCCACGATTGTGGGGGACCTGCTTCCAACCGTCGAAAGACAACTTTATCGAAACTTGACCTCAAATCAGGCGGGACTACCCGCTGAACTTAAGCATATCAATAA |
| Name of Depositor: | J Stenlid |
| Special Collection: | ATCC |
| Chain of Custody: | ATCC |
| Isolation: | Dead standing tree of Pinus resinosa, Lyndonville, Vermont, USA. |
| Cross References: | Nucleotide (GenBank) : KC881090 ITS including 5.8S rRNA gene Nucleotide (GenBank) : AEOJ00000000 Heterobasidion irregulare TC 32-1, whole genome shotgun sequencing project |
| References: | Olson A, Stenlid J. Mitochondrial control of fungal hybrid virulence. Nature 409: 438, 2001. Olson A, et al. Insight into trade-off between wood decay and parasitism from the genome of a fungal forest pathogen. New Phytol 194: 1001-1013, 2012. PubMed: 22463738 |