| 产品名称: | Saccharomyces cerevisiae Meyen ex E.C. Hansen |
|---|---|
| 商品货号: | TS143155 |
| Deposited As: | Saccharomyces cerevisiae Hansen, teleomorph |
| Classification: | Saccharomycetes, Saccharomycetidae, Saccharomycetales, Saccharomycetaceae, Saccharomycetaceae, Saccharomyces, cerevisiae |
| Strain Designations: | DJTD2-16A |
| Alternate State: | Candida robusta Diddens et Lodder |
| Biosafety Level: | 1
Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country. |
| Product Format: | frozen |
| Type Strain: | no |
| Genotype: | MATa ura3-52 his4 leu2 trp1 gal2 cdc42-1
Ref![]() Johnson DI, Pringle JR. Molecular characterization of CDC42, a Saccharomyces cerevisiae gene involved in the development of cell polarity. J. Cell Biol. 111: 143-152, 1990. PubMed: 2164028 |
| Preceptrol®: | no |
| Mating Type: | a |
| Ploidy: | haploid |
| Comments: | High temperature sensitive lethality: cell cycle (CP2) The temperature-sensitive phenotype of many cdc mutants is not immediately obvious as cells may increase in mass at 36C even though they do not divide properly. Microscopic examination should clarify this condition. |
| Medium: | ATCC® Medium 1069: YPAD medium |
| Growth Conditions: | Temperature: 25.0°C Atmosphere: Typical aerobic |
| Sequenced Data: | xa0xa0xa0 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence.
AAAGAAATTTAATAATTTTGAAAATGGATTTTTTTGTTTTGGCAAGAGCATGAGAGCTTTTACTGGGCAAGAAGACAAGAGATGGAGAGTCCAGCCGGGCCTGCGCTTAAGTGCGCGGTCTTGCTAGGCTTGTAAGTTTCTTTCTTGCTATTCCAAACGGTGAGAGATTTCTGTGCTTTTGTTATAGGACAATTAAAACCGTTTCAATACAACACACTGTGGAGTTTTCATATCTTTGCAACTTTTTCTTTGGGCATTCGAGCAATCGGGGCCCAGAGGTAACAAACACAAACAATTTTATCTATTCATTAAATTTTTGTCAAAAACAAGAATTTTCGTAACTGGAAATTTTAAAATATTAAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCAGGGGGCATGCCTGTTTGAGCGTCATTTCCTTCTCAAACATTCTGTTTGGTAGTGAGTGATACTCTTTGGAGTTAACTTGAAATTGCTGGCCTTTTCATTGGATGTTTTTTTTCCAAAGAGAGGTTTCTCTGCGTGCTTGAGGTATAATGCAAGTACGGTCGTTTTAGGTTTTACCAACTGCGGCTAATCTTTTTTTATACTGAGCGTATTGGAACGTTATCGATAAGAAGAGAGCGTCTAGGCGAACAATGTTCTTAAAGTTGACCTCAAATCAGG |
| Name of Depositor: | YGSC |
| Special Collection: | Yeast Genetic Stock Center |
| Chain of Custody: | ATCC < |
| References: | Johnson DI, Pringle JR. Molecular characterization of CDC42, a Saccharomyces cerevisiae gene involved in the development of cell polarity. J. Cell Biol. 111: 143-152, 1990. PubMed: 2164028 Johnson DI, Pringle JR. Molecular characterization of CDC42, a Saccharomyces cerevisiae gene involved in the development of cell polarity. J. Cell Biol. 111: 143-152, 1990. PubMed: 2164028 |

Johnson DI, Pringle JR. Molecular characterization of CDC42, a Saccharomyces cerevisiae gene involved in the development of cell polarity. J. Cell Biol. 111: 143-152, 1990. PubMed: 2164028