微信小陈
微信小章| 产品名称： | Allomyces macrogynus (Emerson) Emerson et Wilson |
|---|---|
| 商品货号： | TS144106 |
| Strain Designations： | Burma 3-35 |
| Application： | classroom demonstration |
| Biosafety Level： | 1
Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country. |
| Product Format： | test tube |
| Storage Conditions： | Frozen: -80°C or colder Freeze-Dried: 2°C to 8°C Live Culture: See Propagation Section |
| Type Strain： | no |
| Preceptrol®： | no |
| Genome Sequenced Strain： | Yes |
| Comments： | Motility Male gamete messenger RNA Autotetraploid Genome sequencing strain (Broad Institute, USA). |
| Morphology： | After 2 weeks advancing zone appressed, mycelium white with older growth turning butyrous and orange as zoosporangia are formed. |
| Medium： | ATCC® Medium 350: Emerson YpSs agar |
| Growth Conditions： | Temperature: 24°C to 26°C Atmosphere: Typical aerobic |
| Sequenced Data： |
D1D2 region of the 28S ribosomal RNA gene
CGAGTAATGGCGAATGAAACGGGAAAAGCCCAAATTTGAAATCTCCTAGCTTTTATCGCTAGGCGAGTTGTAATTTGTAGAAGGTCTTCATCTGAACTGTGTTTGCTAAAGTCCATTGGAAAATGGCGGGCCTTTATGGTCCTCAAGTCGTAGAGGGTGACAACCCCGTTCTTGGCATTCTACTAGTTCTTTTGTATGATTCCTTCAAAGAGTCGGATTGTTTGGGAATGCAATCCAAAACGGGTGGTAAATTCCATCCAAGGCTAAATATTAGCAAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTCTGAAGAGAGAGTTCAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGAAACGATTGTTGCTTTTGGTTTCGGCCTTGAGCGAGTCAGCAGCAGTTTTAAACGGTAAAGAAGTGCTTGTGGAAGGTAGTTTTCTTTGGAAAATGTTATAGCCATAAGTAACTGTGCCGGTTAGGACTGAGGATCGCTTTTAAGTGTCTTGTCGAGGAATTTTGGGCCGTTAGCGCCAAGGCCTTGGGCTTGCTCAAGACTTGGTGTTAACTGTTCAGGACGACCAAACACAAGGCCTTAAAAT |
| Name of Depositor： | J Pommerville |
| Chain of Custody： | ATCC <-- J Pommerville <-- R. Emerson |
| Isolation： | Pond soil |
| Cross References： | Nucleotide (GenBank) : JX094785 D1/D2 region of 28S rRNA gene Nucleotide (GenBank) : ACDU00000000 Allomyces macrogynus ATCC 38327, whole genome shotgun sequencing project |
| References： | Morrison PJAllomyces macrogynusIn: Morrison PJLower fungi in the laboratoryAthens, GAUniv. Georgiapp. 45-46, 1978 Eisenberg A, Mascarenhas JP. Male gamete messenger RNAs in Allomyces. Exp. Mycol. 5: 173-177, 1981. Pommerville J. Analysis of gamete and zygote motility in Allomyces. Exp. Cell Res. 113: 161-172, 1978. PubMed: 565293 . . Protoplasma 100: 323-343, 1979. Aronson JM, Sandstedt V. Allomyces macrogynusIn: Aronson JM, Sandstedt V. Lower fungi in the laboratory. Athens, GA Univ. Georgia. pp. 51-52, 1978. Barstow WE. Allomyces macrogynusIn: Barstow WE. Lower fungi in the laboratory, Athens, GA Univ. Georgia. pp. 49-50, 1978. Pommerville J. Allomyces macrogynus--gametes and fertilizationIn: Pommerville J. Lower fungi in the laboratory. Athens, GA Univ. Georgia. pp. 47-48, 1978. Liu YJ, Hodson MC, Hall BD. Loss of the flagellum happened only once in the fungal lineage: phylogenetic structure of kingdom Fungi inferred from RNA polymerase II subunit genes BMC Evol Biol 6: 74, 2006. PubMed: 17010206 Spatafora JW, et al. A phylum-level phylogenetic classification of zygomycete fungi based on genome-scale data. Mycologia 108:1028-1046, 2016. PubMed: 27738200 |