微信小陈
微信小章| 产品名称： | HFBCB31 |
|---|---|
| 商品货号： | TS149113 |
| Designations： | HFBCB31 |
| GenBank Number： | M78393 |
| Species： | Homo sapiens, human |
| Applications： | Expected product size (bp): 150. Observed product sizes (bp): 152 (human). |
| Vector： | Construct size (kb): 5.400000095367432 DESCRIPTION OF VECTOR COMPONENT: Name of vector: pBluescript SK- Intact vector size: 2.960 Type of vector: phagemid Vector end: EcoRI Vector end: EcoRI Cloning sites: KpnI ApaI DraII XhoI (SalI HincII AccI) ClaI HindIII EcoRV EcoRI PstI SmaI BamHI SpeI XbaI EagI NotI SacII BstXI SacI Polylinker sites: SacI BstXI SacII NotI EagI XbaI SpeI BamHI SmaI PstI EcoRI EcoRV HindIII (ClaI Bsp106I) (HincII AccI SalI) XhoI (Eco0109I DraII ApaI) KpnI Construction: pUC19 Host range: Escherichia coli Features (with orientation and position when available): replicon: f1, -> insert detection: lacZ, primer site: M13-20, -> promoter: T7, -> MCS: KpnI...SacI, -> promoter: T3, promoter: lac, primer site: M13 reverse, replicon: pMB1 marker(s): ampR, Cross references: |
| Insert： | DNA: cDNA DESCRIPTION OF INSERT COMPONENT: Genome: Homo sapiens Gene symbol: GST* Gene name: glutathione S-transferase Contains complete coding sequence?: U Chromosome: 21 Genome: Homo sapiens Gene symbol: D21S363E Genomic copy number: unique Gene name: DNA Segment, single copy, expressed Contains complete coding sequence?: U Chromosome: 21; Localization: 21 Tissue: fetal brain, female, 17-18 wk (Stratagene 936206) Type of DNA: cDNA Insert end: Modification: EcoRI linkers Insert end: Modification: EcoRI linkers Insert size (kb): 2.4 Cross references: DNA Seq. Acc.: M78393; EST: EST00541; Primer: M13 Forward Insert lengths(kb): 2.400000095367432 Tissue: fetal brain, female, 17-18 wk (Stratagene 936206) Gene product: glutathione S-transferase GST* |
| Insert Size (kb)： | 2.400 |
| Biosafety Level： | 1
Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country. |
| Shipping Information： | Distributed: DNA (dried). Rehydrate with TE. (amount: 200 ng) |
| Comments： | Restriction digests of the clone give the following sizes (kb): EcoRI--3.0, 1.3, 1.1; PstI--5.4; HindIII--3.6, 1.8. EST00541 can be detected in genomic DNA using the following oligonucleotides (5-3): CCGTCGGTAACAGAAAACTC and ACACAGTCCTGTAATACCCTCC. The 1.1 kb fragment contains EST00541. The 1.3 kb fragment does not map to chromosome 21 and contains sequences homologous to glutathione S-transferase. Expected product size (bp): 150. Observed product sizes (bp): 152 (human). |
| References： | Adams MD, et al. Sequence identification of 2,375 human brain genes. Nature 355: 632-634, 1992. PubMed: 1538749 Durkin AS, et al. Chromosomal assignment of 39 human brain expressed sequence tags (ESTs) by analyzing fluorescently-labeled PCR products from hybrid cell panels. Genomics 14: 808-810, 1992. PubMed: 1427913 Maglott DR, et al259 human brain expressed sequence tags (ESTs): chromosome localization, subregional assignment, and sequence analysisIn: Maglott DR, et alIdentification of transcribed sequencesNew YorkPlenum Presspp. 273-288, 1994 |