微信小陈
微信小章| 产品名称： | Aureobasidium pullulans (de Bary) Arnaud |
|---|---|
| 商品货号： | TS152293 |
| Deposited As： | Aureobasidium pullulans (de Bary) Arnaud, anamorph |
| Strain Designations： | NRRL Y-2311-1 |
| Application： | degrades xylan produces acetylesterase acetyl esterase produces alpha-L-arabinofuranosidase alpha-1,3-arabinosidase produces beta-xylanase produces exo-1,4-beta-D-xylosidase beta-xylosidase produces p-nitrophenyl xylosidase produces pullulan produces xylan endo-1,3-beta-xylosidase xylan hydrolase, xylanase degrades xylan from dissolving pulp |
| Biosafety Level： | 1
Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country. |
| Product Format： | freeze-dried |
| Type Strain： | no |
| Preceptrol®： | no |
| Genome Sequenced Strain： | Yes |
| Comments： | saccharification of corn fiber Genome sequencing strain (Concordia University, Canada). |
| Morphology： | After 6 days on YM medium at 25°C, colonies are cream colored, flat, smooth. Hyphae are hyaline, yeast cells ellipsoid, single or with bud. |
| Medium： | ATCC® Medium 28: Emmons modification of Sabourauds agar ATCC® Medium 200: YM agar or YM broth ATCC® Medium 1245: YEPD |
| Growth Conditions： | Temperature: 20°C to 25°C
Atmosphere: Typical aerobicxa0 |
| Sequenced Data： |
18S ribosomal RNA gene, partial sequence; internalxa0xa0 transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence.
GAAGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTAAAGAGTAAGGGTGCTCAGCGCCCGACCTCCAACCCTTTGTTGTTAAAACTACCTTGTTGCTTTGGCGGGACCGCTCGGTCTCGAGCCGCTGGGGATTCGTCCCAGGCGAGCGCCCGCCAGAGTTAAACCAAACTCTTGTTATCAAACCGGTCGTCTGAGTTAAAATTTTGAATAAATCAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATTACACCACTCAAGCTATGCTTGGTATTGGGTGCCGTCCTTAGTTGGGCGCGCCTTAAAGACCTCGGCGAGGCCTCACCGGCTTTAGGCGTAGTAGAATTTATTCGAACGTCTGTCAAAGGAGAGGACTTCTGCCGACTGAAACCTTTATTTTTCTAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAG xa0D1D2 region of the 26S ribosomal RNA gene. CATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAAGCTGGCCTTCGGGTCCGCATTGTAATTTGTAGAGGATGCTTTGGGTGAAACGCCAGTCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGACTGGAAATGTTAACCTATGTAAAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCGAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAATCAGACTTGTTTAAACTGTTCGGCCGGTCTTCTGACCGGTTTACTCAGTTTGGACAGGCCAGCATCAGTTTCGGCGGCCGGATAAAGGCTCTGGGAATGTGGCCTTCACTTCGGTGAAGGTGTTATAGCCCAGGGTGTAATACGGCCAGCCGGGACTGAGGTCCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTAAGCGAC |
| Name of Depositor： | TD Leathers |
| Cross References： | Nucleotide (GenBank) : U10298 xynA gene |
| References： | Leathers TD. Color variants of Aureobasidium pullulans overproduce xylanase with extremely high specific activity. Appl. Environ. Microbiol. 52: 1026-1030, 1986. Li XL, et al. Purification and characterization of a new xylanase (APX-II) from the fungus Aureobasidium pullulans Y-2311-1. Appl. Environ. Microbiol. 59: 3212-3218, 1993. PubMed: 8250548 Myburgh J, et al. The temperature and pH properties of the extracellular hemicellulose-degrading enzymes of Aureobasidium pullulans NRRL Y 2311-1. Process Biochem. 26: 343-348, 1991. Li XL, Ljungdahl LG. Cloning, sequencing, and regulation of a xylanase gene from the fungus Aureobasidium pullulans Y-2311-1 published erratum appears in Appl. Environ. Microbiol. 60: 4647, 1994. Appl. Environ. Microbiol. 60: 3160-3166, 1994. PubMed: 7944361 . . Biotechnol. Lett. 15: 1269-1274, 1993. Gupta SC, Leathers TD. Saccharification of corn fiber using enzymes from Aureobasidium sp. strain NRRL Y-2311-1. Appl. Biochem. Biotechnol. 59: 337-347, 1996. Kremnicky L, Biely P. beta-Mannanolytic system of Aureobasidium pullulans. Arch. Microbiol. 167: 350-355, 1997. Christov LP, et al. Modification of the carbohydrate composition of sulfite pulp by purified and characterized beta-xylanase and beta-xylosidase of Aureobasidium pullulans. Biotechnol. Prog. 15: 196-200, 1999. PubMed: 10194394 Gibson LH, Coughlin RW. Optimization of high molecular weight pullulan production by Aureobasidium pullulans in batch fermentations. Biotechnol. Prog. 18: 675-678, 2002. PubMed: 12052094 Leathers TD. Overproduction and regulation of xylanase in Aureobasidium pullulans and Cryptococcus albidus. Biotechnol. Bioeng. Symp. 14: 225-240, 1984. |