微信小陈
微信小章| 产品名称： | Exophiala dermatitidis (Kano) de Hoog |
|---|---|
| 商品货号： | TS154737 |
| Deposited As： | Wangiella dermatitidis (Kano) McGinnis |
| Strain Designations： | JL-3 Mel-3 |
| Application： | Biomedical Research and Development Material |
| Biosafety Level： | 2
Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country. |
| Product Format： | freeze-dried |
| Type Strain： | no |
| Genotype： | mel3
Ref  Brush L, Money NP. Invasive hyphal growth in Wangiella dermatitidis is induced by stab inoculation and shows dependence upon melanin biosynthesis. Fungal Genet. Biol. 28: 190-200, 1999. PubMed: 10669584 |
| Phenotype： | melanin-deficient
RefBrush L, Money NP. Invasive hyphal growth in Wangiella dermatitidis is induced by stab inoculation and shows dependence upon melanin biosynthesis. Fungal Genet. Biol. 28: 190-200, 1999. PubMed: 10669584 |
| Preceptrol®： | no |
| Ploidy： | haploid |
| Comments： | Synthesis of melanin-like pigments |
| Morphology： | melanin-deficient
RefBrush L, Money NP. Invasive hyphal growth in Wangiella dermatitidis is induced by stab inoculation and shows dependence upon melanin biosynthesis. Fungal Genet. Biol. 28: 190-200, 1999. PubMed: 10669584 |
| Medium： | ATCC® Medium 28: Emmons modification of Sabourauds agar |
| Growth Conditions： | Temperature: 24.0°C |
| Sequenced Data： | 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence.
TCTTCTCAGGCCCGACCTCCCACCCTTTGTTTACCCGACCCATGTTGCTTCGGCGGGCCCGCCGTTTCGACGGCCGCCGGAGGACCGCCTATTCAGGTCCTCTGGCCCGCGCCCGCCGGTAGCCAATTCTACCAAACTCTTGAATCAAATCGTGTCCAATGTCTGAGTATATTACAAAATAAAAGCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGCGAATTGCAGAATTCCAGTGAGTCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCGAAGGGCATGCCTGTTCGAGCGTCATTATCACCCCTCAAGCCCCCCGGCTTGGTGTTGGACGGTCTGGTCGAGCGTTTCCGCGCGACCCCTCCCAAAGACAATGACGGCGGCCTGGTTGGACCCCCGGTACACGGAGCTTCTTCACTGAGCACGTATCGGTTTCAAGGTGTCCCCGGGACCCGGTCGACCTCTCTTGCTCCCCTGCGGGAGTGGGAGAGAACCCCCCTTTTTATCAAGGTTGACCTCGGATCAGGTAGGAATACCCGCTGAACTTAAGCATATCA xa0 |
| Name of Depositor： | PA Geis |
| Isolation： | albino mutant derived from ATCC 34100 |
| Cross References： | Nucleotide (GenBank) : GU256756 ITS including 5.8S rRNA gene |
| References： | Geis PA, et al. Pentaketide metabolites of melanin synthesis in the dematiaceous fungus Wangiella dermatitidis. Arch. Microbiol. 137: 324-328, 1984. PubMed: 6539583 Schnitzler N, et al. Effect of melanin and carotenoids of Exophiala (Wangiella) dermatitidis on phagocytosis, oxidative burst, and killing by human neutrophils. Infect. Immun. 67: 94-101, 1999. PubMed: 9864201 Brush L, Money NP. Invasive hyphal growth in Wangiella dermatitidis is induced by stab inoculation and shows dependence upon melanin biosynthesis. Fungal Genet. Biol. 28: 190-200, 1999. PubMed: 10669584 Brush L, Money NP. Invasive hyphal growth in Wangiella dermatitidis is induced by stab inoculation and shows dependence upon melanin biosynthesis. Fungal Genet. Biol. 28: 190-200, 1999. PubMed: 10669584 Brush L, Money NP. Invasive hyphal growth in Wangiella dermatitidis is induced by stab inoculation and shows dependence upon melanin biosynthesis. Fungal Genet. Biol. 28: 190-200, 1999. PubMed: 10669584 Brush L, Money NP. Invasive hyphal growth in Wangiella dermatitidis is induced by stab inoculation and shows dependence upon melanin biosynthesis. Fungal Genet. Biol. 28: 190-200, 1999. PubMed: 10669584 Brush L, Money NP. Invasive hyphal growth in Wangiella dermatitidis is induced by stab inoculation and shows dependence upon melanin biosynthesis. Fungal Genet. Biol. 28: 190-200, 1999. PubMed: 10669584 |