微信小陈
微信小章| 产品名称： | Blastomyces dermatitidis Gilchrist et Stokes |
|---|---|
| 商品货号： | TS155639 |
| Strain Designations： | SCB-2 |
| Alternate State： | Ajellomyces dermatitidis McDonough et Lewis |
| Application： | Biomedical Research and Development Material Emerging infectious disease research |
| Biosafety Level： | 3
Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country. |
| Product Format： | frozen |
| Storage Conditions： | Frozen: -80°C or colder Freeze-Dried: 2°C to 8°C Live Culture: See Propagation Section |
| Type Strain： | no |
| Preceptrol®： | no |
| Genome Sequenced Strain： | Yes |
| Comments： | Experimental infection in mice and model of pulmonary blastomycosis
Macrophage induction
Genome sequencing strain (The Genome Sequencing Center (GSC) at Washington University, USA). |
| Medium： | ATCC® Medium 28: Emmons modification of Sabourauds agar ATCC® Medium 2166: Dubos with oleic albumin ATCC® Medium 336: Potato dextrose agar (PDA) |
| Growth Conditions： | Temperature: 37°C
Atmosphere: Typical aerobic |
| Sequenced Data： |
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence
CATTAACGCGCCGTGGGGGGTTGGACCTCCTAGACCGGAGGAACCCCGGCCCCCTCACCTGGCCACCCTTGTCTATTTTTACCTGTTGCTTCGGCGGGCCTGCAGCGATGCTGCCGGGGGAGTTTTCACTCCCCGGGCTCGTGCCCGCCGAGGACACCGCTAGAACTTCTGGTGAACGATTGACATCTGAGAAAATAACTATAATCAGTTAAAACTTTCAACAACGGATCTCTTGGTTCCGACATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTCTGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTGCAACCCTCAAGCGCGGCTTGTGTGTTGGGCCTTCGTCCCCCCGTGGACGTGCCCGAAATGCAGCGGCGGCGTCGTGTTCCGGTGCCCGAGCGTATGGGGCTTTGTCACCCGCTCTAGAGGCCCGGCCGGCTCCGGCCCCATCTCAAACCCTTCGAGGGAGGGCGGTCTTCGGGCCGGTCTCCCCACCAGGTTGACCTCGGATCAGGTAGGAATACCCGCTGAACTTAAG |
| Name of Depositor： | RA Cox |
| Chain of Custody： | ATCC |
| Isolation： | Human |
| Cross References： | Nucleotide (GenBank) : M63096 Blastomyces dermatitidis 18S ribosomal RNA. Nucleotide (GenBank) : U37772 Ajellomyces dermatitidis WI-1 adhesin gene, complete cds. Nucleotide (GenBank) : AF159367 Ajellomyces dermatitidis bacterial-type chitinase (CTS1) mRNA, Complete Genome (GenBank) : AEII00000000 Ajellomyces dermatitidis TS155639, whole genome shotgun sequencing project |
| References： | Brummer E, et al. Macrophages and fungi: in vitro effects of method of macrophage induction, activation by different stimuli, and soluble factors on Blastomyces. J. Reticuloendothel. Soc. 28: 507-518, 1980. PubMed: 7463412 Harvey RP, et al. Mouse model of pulmonary blastomycosis: utility, simplicity, and quantitative parameters. Am. Rev. Respir. Dis. 117: 695-703, 1978. PubMed: 646221 Hogan LH, Klein BS. Transforming DNA integrates at multiple sites in the dimorphic fungal pathogen Blastomyces dermatitidis. Gene 186: 219-226, 1997. PubMed: 9074500 Sorensen KN, et al. Murine models of blastomycosis, coccidioidomycosis, and histoplasmosis. Mycopathologia 146: 53-65, 1999. Shearer G Jr., Larsh HW. Chitin synthetase from the yeast and mycelial phases of Blastomyces dermatitidis. Mycopathologia 90: 91-96, 1985. PubMed: 3159966 Brown EM, et al. Phylogenetic analysis reveals a cryptic species Blastomyces gilchristii, sp. nov. within the human pathogenic fungus Blastomyces dermatitidis. PLoS One 8: e59237, 2013. PubMed: 23533607 Theodoro RC, et al. PRP8 intein in Ajellomycetaceae family pathogens: Sequence analysis, splicing evaluation and homing endonuclease activity. Fungal Genet Biol 48: 80-91, 2011. PubMed: 20682355 Meece JK, et al. Genetic diversity in Blastomyces dermatitidis: implications for PCR detection in clinical and environmental samples. Med Mycol 48: 285-290, 2010. PubMed: 19626547 Nemecek JC, Wuthrich M, Klein BS. Global control of dimorphism and virulence in fungi. Science 312: 583-588, 2006. PubMed: 16645097 |