微信小陈
微信小章| 产品名称： | Cutaneotrichosporon mucoides (Guého et Smith) Liu et al. |
|---|---|
| 商品货号： | TS162124 |
| Deposited As： | Trichosporon mucoides Gueho et Smith |
| Strain Designations： | CBS 7625 IP 151 |
| Application： | Biomedical Research and Development Material |
| Biosafety Level： | 2
Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country. |
| Product Format： | freeze-dried |
| Storage Conditions： | Frozen: -80°C or colder Freeze-Dried: 2°C to 8°C Live Culture: See Propagation Section |
| Type Strain： | yes |
| Preceptrol®： | no |
| Medium： | ATCC® Medium 28: Emmons modification of Sabourauds agar ATCC® Medium 200: YM agar or YM broth ATCC® Medium 1245: YEPD |
| Growth Conditions： | Temperature: 30°C
Atmosphere: Typical aerobic |
| Sequenced Data： |
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence
GGTTTCCGTAGGTGAACCTGCGGAAGGATCATTAGTGAATTGCTCTCTGAGCGTTAAACTATATCCATCTACACCTGTGAACTGTTGATTGACTTCGGTCGATTACTTTTACAAACATTGTGTAATGAACGTCATGTTATTATAACAAAAATAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCAACTTGCGCTCTCTGGTATTCCGGAGAGCATGCCTGTTTGAGTATCATGAAATCTCAACCATTAGGGTTTCTTAATGGCTTGGATTTGGGCGCTGCCACTTGCCTGGCTCGCCTTAAAGGAGTTAGCGTATTAACTTGTCGATCTGGCGTAATAAGTTTCGCTGGTGTAGACTTGAGAAGTGCGCTTCTAATCGTCCTCGGACAATTCTTGAACTCTGGTCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAA D1D2 region of the 26S ribosomal RNA gene ATATCAATAAGCGGAGGAAAAGAAACTAACAAGGATTCCCTTAGTAACGGCGAGTGAACCGGGAAAAGCTCAAATTTGTAATCTGGCTGTCTTCGATAGTCCGAGTTGTAATCTATAGACGTGTTTTCCGTGCTGGACCGTATCTAAGTCCCTTGGAACAGGGTATCAAAGAGGGTGACAATCCCGTGCTTGATACGACCACCAGTGCTCTGTGATACACGCTCTACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACGATTGAAGTCAGTCGTGTTCTTTGGATTCAGCTAGTTCTTCTAGTCTACTTCCATTGAACGGGTCAACATCAGTTTTGTCCGGTGGATAAAGATAGTAGGAATGTAGCTCCCTCGGGAGTGTTATAGACTATTATTGCATACACTGGGTGAGACTGAGGACTGCAGCTCGCCTTTTGGCCGGTCTTCGGACACGTTCGAGCTTAGGATGTTGACATAATGGCTTTAAACGAC |
| Name of Depositor： | CBS |
| Chain of Custody： | ATCC <-- CBS <-- I. Surmont IP 151 |
| Isolation： | Meninges of patient with lymphocytic leukemia, Belgium |
| Cross References： | Nucleotide (GenBank) : KM821090 D1/D2 region of 26S rRNA gene Nucleotide (GenBank) : KM821111 ITS including 5.8S rRNA gene Nucleotide (GenBank) : KM821100 26S-5S ribosomal RNA intergenic spacer (IGS) |
| References： | Gueho E, et al. Contributions to a revision of the genus Trichosporon. Antonie van Leeuwenhoek 61: 289-316, 1992. PubMed: 1497334 Fell JW, et al. Biodiversity and systematics of basidiomycetous yeasts as determined by large-subunit rDNA D1/D2 domain sequence analysis. Int. J. Syst. Evol. Microbiol. 50: 1351-1371, 2000. PubMed: 10843082 Suh SO, et al. Characterization of medically important yeast Trichosporon mucoides and its close sister Trichosporon dermatis by traditional and advanced technologies. J. Med. Microbiol. 64: 1135–1143, 2015. PubMed: 26296931 Hamano K, et al. Genome profiling (GP) as an effective tool for monitoring culture collections: A case study with Trichosporon. J. Microbiol Methods 89: 119-128, 2012. PubMed: 22401825 Chagas-Neto TC, et al. Bloodstream infections due to Trichosporon spp.: species distribution, Trichosporon asahii genotypes determined on the basis of ribosomal DNA intergenic spacer 1 sequencing, and antifungal susceptibility testing. J. Clin. Microbiol. 47: 1074-1081, 2009. PubMed: 19225102 Sugita T, et al. Sequence analysis of the ribosomal DNA intergenic spacer 1 regions of Trichosporon species. J. Clin. Microbiol. 40: 1826-1830, 2002. PubMed: 11980969 Scorzetti G, et al. Systematics of basidiomycetous yeasts: a comparison of large subunit D1/D2 and internal transcribed spacer rDNA regions. FEMS Yeast Res. 2: 495–517, 2002. PubMed: 12702266 Biswas SK, et al. Molecular phylogenetics of the genus Rhodotorula and related basidiomycetous yeasts inferred from the mitochondrial cytochrome b gene. Int. J. Syst. Evol. Microbiol. 51: 1191-1199, 2001. PubMed: 11411687 Sugita T, et al. Identification of medically relevant Trichosporon species based on sequences of internal transcribed spacer regions and construction of a database for Trichosporon identification. J. Clin. Microbiol. 37: 1985-1993, 1999. PubMed: 10325360 Fell JW, Roeijmans H, Boekhout T. Cystofilobasidiales, a new order of basidiomycetous yeasts. Int. J. Syst. Bacteriol. 49: 907-913, 1999. PubMed: 10319517 Sugita T, Nakase T. Molecular phylogenetic study of the basidiomycetous anamorphic yeast genus Trichosporon and related taxa based on small subunit ribosomal DNA sequences. Mycoscience 39: 7-13, 1998. Liu XZ, et al. Towards an integrated phylogenetic classification of the Tremellomycetes. Stud. Mycol. 81: 85-147, 2015. PubMed: 26955199 |