| 产品名称: | Rhizomucor pusillus (Lindt) Schipper |
|---|---|
| 商品货号: | TS162510 |
| Deposited As: | Mucor pusillus Lindt, teleomorph |
| Application: | produces amylase |
| Biosafety Level: | 1
Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country. |
| Product Format: | freeze-dried |
| Type Strain: | no |
| Preceptrol®: | no |
| Morphology: | Colony characteristics. Colonies (MEA, 30°C) expanding, brownish. Microscopy. Sporangiophores originating from aerial hyphae or from stolons, with branched, thin-walled rhizoids. Sporangiophores brownish, 11-15 ?m wide, apical branches each terminating with a sporangium. Sporangia spherical, up to 100 ?m diam; membrane diffluent; columella (sub)spherical to pyriform, about 40 ?m wide, without apophysis. Sporangiospores hyaline, smooth-walled, (sub)spherical, 3-4 ?m diam.xa0 Zygospores spherical to slightly compressed, up to 70 ?m wide, dark brown to blackish-brown, with stellate warts. |
| Medium: | ATCC® Medium 336: Potato dextrose agar (PDA) |
| Growth Conditions: | Temperature: 37.0°C |
| Sequenced Data: | 18S ribosomal RNA gene, partial sequence; internalxa0xa0 transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence.
TGCGGAAGGATCATTAAAAAGTTGTGGAAATCGTGGTGACCTCTATTGGTGAGCCGCGATTCTCTCCTTTTTGTGAAATGTTCTGAGGGATTGCTCCAGATCTCTCGACCTTTTATTTTACATATTTGATTGACTGTTGTTTAACAAATTGAAAGTTTTGGATCAGAAATGATTCAAGACGATAAAATTTCAAAACAACTTTAAGCAATGGATCACTTGGTTCTCGCATCGATGAAGAGCGTAGCAAATTGCGAAAAGTAATGCGATCTGCAGCCTTTGCGAATCATCGAATTCTCGAACGCACCTTGCACCCTTTGGTTCATCCATTGGGTACGTCTAGTTCAGTATCTTTATTAACCCCTAAAGGTTTATTTTTTGATAAATCTTTGGATTTGCGGTGCTGATGGATTTTCATCCGTTCAAGCTACCCGAACAATTTGTATGTTGTTGACCCTTGATATTTCCTTGAGGGCTTGCATTGGTATCTAATTTTTTACCAGTGTGCTTCGAGATGATCAAGTATAAAGGTCAATCAACCACAAATAAATTTCAACTATGGATCTGAACTTAGATGGGATTA |
| Name of Depositor: | RP Adams |
| Chain of Custody: | ATCC < |
| References: | Adams PR. Amylase production by Mucor pusillus and Humicola lanuginosa as related to mycelial growth. Mycopathologia 76: 97-101, 1981. |