| 产品名称: | Candida oxycetoniae Bai et Ji |
|---|---|
| 商品货号: | TS163522 |
| Strain Designations: | HJG-1.1.1 AS 2.3656, CBS 10844 |
| Biosafety Level: | 1
Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country. |
| Product Format: | frozen |
| Storage Conditions: | Frozen: -80°C or colder Freeze-Dried: 2°C to 8°C Live Culture: See Propagation Section |
| Type Strain: | yes |
| Preceptrol®: | no |
| Comments: | Insect associated yeast. |
| Medium: | ATCC® Medium 28: Emmons modification of Sabourauds agar ATCC® Medium 200: YM agar or YM broth ATCC® Medium 1245: YEPD |
| Growth Conditions: | Temperature: 25°C
Atmosphere: Typical aerobic |
| Sequenced Data: |
ITS DNA sequence of MYA-4594 lot 58704090 GTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTACTGAAAATGTGAGTGCTTAATTGCATTTATCCACATGTGTTTTTCCATTTTTTTGAATAAACTTTGCTTTGGCGGTTCTAAACTGCCGCCAGAGACTTTAAAACTCAAACCTGATTTTTTTTAAATAAAACTAGTCAACGATTATATTTTTTAATAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATATGAATTGCAGATATTCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTCTGGTATTCCAGAGGGCATGCCTGTTTGAGCGTCATTTCTCCCTCAAACCTCTAAGGTTTGGTGATGAGCAATACGCTTTTATGGTTTGCTTGAAAGAAAGAAGAAGATTTGAAAAACAATGTATTAGGTACAACCCACTCATTGGAAAAAGAATCTTCGCCTTAAATTCTTCCAAATTCGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATAT |
| Name of Depositor: | FY Bai |
| Special Collection: | ATCC |
| Chain of Custody: | ATCC |
| Isolation: | Gut of Oxycetonia jucunda, Baiwangshan Mountain, Beijing, China. |
| Cross References: | Nucleotide (GenBank) : GU291262 ITS including 5.8S rRNA gene |
| References: | Ji ZH, Jia JH, Bai FY. Four novel Candida species in the Candida albicans/ Lodderomyces elongisporus clade isolated from the gut of flower beetles. Antonie van Leeuwenhoek 95: 23-32, 2009. |