| 产品名称: | HHCPF54 |
|---|---|
| 商品货号: | TS163809 |
| Designations: | HHCPF54 |
| GenBank Number: | M78093 |
| Species: | Homo sapiens, human |
| Applications: | The predicted product size is (bp): 142. The observed product size(s) is(are) (bp): 284 (human). |
| Vector: | Construct size (kb): 4.400000095367432 DESCRIPTION OF VECTOR COMPONENT: Name of vector: pBluescript SK- Intact vector size: 2.960 Type of vector: phagemid Vector end: EcoRI Vector end: EcoRI Cloning sites: KpnI ApaI DraII XhoI (SalI HincII AccI) ClaI HindIII EcoRV EcoRI PstI SmaI BamHI SpeI XbaI EagI NotI SacII BstXI SacI Polylinker sites: SacI BstXI SacII NotI EagI XbaI SpeI BamHI SmaI PstI EcoRI EcoRV HindIII (ClaI Bsp106I) (HincII AccI SalI) XhoI (Eco0109I DraII ApaI) KpnI Construction: pUC19 Host range: Escherichia coli Features (with orientation and position when available): replicon: f1, -> insert detection: lacZ, primer site: M13-20, -> promoter: T7, -> MCS: KpnI...SacI, -> promoter: T3, promoter: lac, primer site: M13 reverse, replicon: pMB1 marker(s): ampR, Cross references: |
| Insert: | DNA: cDNA DESCRIPTION OF INSERT COMPONENT: Genome: Homo sapiens Gene symbol: D15S180E Genomic copy number: unique Gene name: DNA Segment, single copy, expressed Contains complete coding sequence?: U Sequence homology: Homo sapiens microtubule-associated protein-5 Chromosome: 15; Localization: 15 q15(21.1)-q22 Tissue: hippocampus, female, 2 years, oligo-dT and random primed (Stratagene 936205), subtracted Type of DNA: cDNA Insert end: Modification: EcoRI linkers Insert end: Modification: EcoRI linkers Insert size (kb): 1.4 Cross references: DNA Seq. Acc.: M78093; EST: EST01683; Primer: M13 Forward Insert lengths(kb): 1.399999976158142 Tissue: hippocampus, female, 2 years, oligo-dT and random primed (Stratagene 936205), subtracted Gene product: microtubule-associated protein-5 Mtap5 |
| Insert Size (kb): | 1.400 |
| Biosafety Level: | 1
Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country. |
| Shipping Information: | Distributed: DNA (dried). Rehydrate with TE. (amount: 200 ng) |
| Comments: | Restriction digests of the clone give the following sizes (kb): EcoRI--3.0, 1.4; BamHI--4.2, 0.2; PstI--3.2, 0.75, 0.5; HindIII--4.4. EST01683 can be detected in genomic DNA using the following oligonucleotides (5-3): GTCCAAAGGCCTAGTCAATG and ACGGAAGAAGTCAAGGTCAG. EST01683 matches PIR accession A33645 with 62% identity and 80% similarity over the sequence range: 195-344. This sequence record is for mouse microtubule associated protein 1b (Mtap-1b). The predicted product size is (bp): 142. The observed product size(s) is(are) (bp): 284 (human). These primers appear to amplify across an intron approximately 140 bp in size that occurs near nt 185 of GENBANK file HUMXT01683. |
| References: | Adams MD, et al. Sequence identification of 2,375 human brain genes. Nature 355: 632-634, 1992. PubMed: 1538749 Maglott DR, et al259 human brain expressed sequence tags (ESTs): chromosome localization, subregional assignment, and sequence analysisIn: Maglott DR, et alIdentification of transcribed sequencesNew YorkPlenum Presspp. 273-288, 1994 J C Venter, personal communication |