| 产品名称: | Phanerochaete chrysosporium Burdsall |
|---|---|
| 商品货号: | TS165814 |
| Deposited As: | Sporotrichum pulverulentum Novobranova |
| Strain Designations: | VKM F-1767 CBS 481.73, CCRC 36200, IMI 174727, NRRL 6361, QM 9998 |
| Alternate State: | Sporotrichum pulverulentum Novobranova, Sporotrichum pruinosum Gilman et Abbott |
| Application: | Bacterial resistance testing adhesives
Degrades 1,1-dichloro-2,2-bis(4-chlorophenyl)ethene DDE
Degrades 2,4,5-trichlorophenol
Degrades 2,4,5-trichlorophenoxyacetic acid 2,4,5-T
Degrades 2,4,6-trichlorophenol
Degrades 2,4,6-trinitrotoluene TNT
Degrades 3,4-dichloroaniline
Degrades Congo red Congo Red
Degrades DDT
Degrades acid yellow 9
Degrades aldrin
Degrades amaranth
Degrades atrazine
Degrades azo dyes
Degrades azure B Azure B
Degrades benzene
Degrades benzo(a)pyrene
Degrades biphenyl
Degrades chlordane
Degrades creosote
Degrades cyclonite RDX, cyclotrimethylene trinitramine
Degrades dieldrin
Degrades ethylbenzene
Degrades fluorene
Degrades heptachlor
Degrades humic acid
Degrades lignin
Degrades lindane
Degrades mirex
Degrades o-chlorophenol
Degrades olive-mill wastewater
Degrades orange G Orange G
Degrades orange II Orange II
Degrades pentachlorophenol
Degrades phenanthrene
Degrades polychlorinated biphenyls
Degrades polycyclic aromatic hydrocarbons
Degrades rose Bengal
Degrades sulfanilic acid
Degrades toluene
Degrades tropaeolin O
Degrades veratryl alcohol
Degrades xylene
Fungus resistance testing adhesives
Produces N-(chlorophenol)-succinimides
Produces NAD(P)H menadione oxidoreductase 1, dioxin-inducible NADH: quinone oxidoreductase, NADH dehydrogenase (quinone)
Produces aryl-alcohol dehydrogenase
Produces cellobiose dehydrogenase (quinone) cellobiose:quinone oxidoreductase
Produces coal-solubilizing agent
Produces glyoxal oxidase
Produces lignin peroxidase diarylpropane oxygenase
Produces manganese peroxidase
Produces peroxidase
Produces xylan endo-1,3-beta-xylosidase xylan hydrolase, xylanase
Degrades diuron |
| Biosafety Level: | 1
Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country. |
| Product Format: | freeze-dried |
| Storage Conditions: | Frozen: -80°C or colder Freeze-Dried: 2°C to 8°C Live Culture: See Propagation Section |
| Type Strain: | yes (type strain of Sporotrichum pulverulentum) |
| Preceptrol®: | no |
| Genome Sequenced Strain: | Yes |
| Comments: | Vitis vinifera
UV- and benomyl-resistant
Degrades pine and straw alkali lignins
Degrades pulp and paper-mill wastewater
Degrades fluorene in soil
Degrades veratryl alcohol and its methyl ether by lignin peroxidase
Decolorizes textile-industry wastewater
Parental strain of RP-78 (genome sequencing strain by the Joint Genome Institute at the Department of Energy, USA)
This strain is also known as BKM-F-1767. |
| Medium: | ATCC® Medium 200: YM agar or YM broth ATCC® Medium 324: Malt extract agar ATCC® Medium 336: Potato dextrose agar (PDA) |
| Growth Conditions: | Temperature: 25°C to 30°C
Atmosphere: Typical aerobic |
| Sequenced Data: |
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence
ACCTGCGGAAGGATCATTAACGAGTAACTGAACAGGTTGTAGCTGGCCTCTCGGGGCATGTGCACGCCTGGCTCATCCACTCTTCAACCTCTGTGCACTTGTTGTAGGTCGGTAGAAGAGCGAGCATCCTCTGATGCTTTGCTTGGAAGCCTTCCTATGTTTTACTACAAACGCTTCAGTTTAAGAATGTCTACCTGCGTACAACGCATCTATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCCTGGTATTCCGGGGAGCATGCCTGTTTGAGTGTCATGGTATCCTCAACCTTCATAACTTTTTGTTATCGAAGGCTTGGACTTGGAGGTTGTGCTGGCTTCTAGTCGAGTCGGCTCCTCTTAAATGTATTAGCGTGAGTGTAACGGATCGCTTCGGTGTGATAATTATCTGCGCCGTGGTCGTGAAGTAACATAAGCTTGCGCTTCTAACCGTCCTTCAGTTGGACAACTTACTTTGACATCTGACCTCAAATCAGGTAGGA
|
| Name of Depositor: | LA Beljakova |
| Chain of Custody: | ATCC <-- LA Beljakova <-- TI Novobranova |
| Isolation: | Fruit and petiole of Vitis vinifera, Alma Ata Region, Kazakhstan |
| Cross References: | Nucleotide (GenBank) : KU729061 ITS including 5.8S rRNA gene Nucleotide (GenBank) : L18991 glyoxal oxidase cDNA Nucleotide (GenBank) : Z11729 cellobiohydrolase CBH1-6 gene, 3 end Nucleotide (GenBank) : X15599 Phanerochaete chrysosporium LIP2 gene for lignin peroxidase. Nucleotide (GenBank) : M18794 Phanerochaete chrysosporium ligninase precursor, mRNA, complete Nucleotide (GenBank) : M21913 Phanerochaete chrysosporium peroxidase isozyme H8 mRNA, partial Nucleotide (GenBank) : X51590 Phanerochaete chrysosporium GLG3 (LIP) gene for lignin peroxidase Nucleotide (GenBank) : X12698 Phanerochaete chrysosporium mRNA for ligninase (rLDM(TM)6) apoprotein Nucleotide (GenBank) : AADS01000000 Phanerochaete chrysosporium RP-78, whole genome shotgun sequencing project. |
| References: | Paszczynski A, et al. Enzymatic activities of an extracellular, manganese-dependent peroxidase from Phanerochaete chrysosporium. FEMS Microbiol. Lett. 29: 37-41, 1985. Leisola MS, et al. Homology among multiple extracellular peroxidases from Phanerochaete chrysosporium. J. Biol. Chem. 262: 419-424, 1987. PubMed: 2432065 Troller J, et al. Crystallization of a lignin peroxidase from the white-rot fungus Phanerochaete chrysosporium. Bio-Technology 6: 571-573, 1988. Kersten PJ, Kirk TK. Involvement of a new enzyme, glyoxal oxidase, in extracellular H2O2 production by Phanerochaete chrysosporium. J. Bacteriol. 169: 2195-2201, 1987. PubMed: 3553159 George EJ, Newfeld RD. Degradation of fluorene in soil by fungus Phanerochaete chrysosporium. Biotechnol. Bioeng. 33: 1306-1310, 1989. Schmidt HW, et al. Oxidative degradation of 3,4-dimethoxybenzyl alcohol and its methyl ether by the lignin peroxidase of Phanerochaete chrysosporium. Biochemistry 28: 1776-1783, 1989. Lin JE, et al. Degradation kinetics of pentachlorophenol by Phanerochaete chrysosporium. Biotechnol. Bioeng. 35: 1125-1134, 1990. Cripps C, et al. Biodegradation of azo and heterocyclic dyes by Phanerochaete chrysosporium. Appl. Environ. Microbiol. 56: 1114-1118, 1990. PubMed: 2339873 Ryan TP, Bumpus JA. Biodegradation of 2,4,5-trichlorophenoxyacetic acid in liquid culture and in soil by the white rot fungus Phanerochaete chrysosporium. Appl. Microbiol. Biotechnol. 31: 302-307, 1989. Kennedy DW, et al. Comparative biodegradation of alkyl halide insecticides by the white rot fungus, Phanerochaete chrysosporium (BKM-F-1767). Appl. Environ. Microbiol. 56: 2347-2353, 1990. PubMed: 1698348 Dehorter B, Blondeau R. Extracellular enzyme activities during humic acid degradation by the white rot fungi Phanerochaete chrysosporium and Trametes versicolor. FEMS Microbiol. Lett. 94: 209-216, 1992. Kersten PJ, Cullen D. Cloning and characterization of a cDNA encoding glyoxal oxidase, a H2O2-producing enzyme from the lignin-degrading basidiomycete Phanerochaete chrysosporium. Proc. Natl. Acad. Sci. USA 90: 7411-7413, 1993. PubMed: 8346264 Mougin C, et al. Biotransformation of the herbicide atrazine by the white rot fungus Phanerochaete chrysosporium. Appl. Environ. Microbiol. 60: 705-708, 1994. Bumpus JA, Tatarko M. Biodegradation of 2,4,6-trinitrotoluene by Phanerochaete chrysosporium: identification of initial degradation products and the discovery of a TNT metabolite that inhibits lignin peroxidases. Curr. Microbiol. 28: 185-190, 1994. Armenante PM, et al. Role of mycelium and extracellular protein in the biodegradation of 2,4,6-trichlorophenol by Phanerochaete chrysosporium. Appl. Environ. Microbiol. 60: 1711-1718, 1994. PubMed: 8031074 Leisola M, et al. Production and identification of extracellular oxidases of Phanerochaete chrysosporium. J. Biotechnol. 2: 379-382, 1985. Novobranova TI. New spp. of fungi imperfecti from the Alma-Ata region. Nov. Sist. Nizshikh. Rast. 9: 180-187, 1972. Torzilli AP, Isbister JD. Comparison of coal solubilization by bacteria and fungi. Biodegradation 5: 55-62, 1994. Bumpus JA, et al. Biodegradation of DDE (1,1-dichloro-2,2-bis(4-chlorophenyl)ethene) by Phanerochaete chrysosporium. Mycol. Res. 97: 95-98, 1993. Mougin C, et al. Biotransformation of the insecticide lindane by the white rot basidiomycete Phanerochaete chrysosporium. Pestic. Sci. 47: 51-59, 1996. Gogna E, et al. Biodegradation of rose Bengal by Phanerochaete chrysosporium. Lett. Appl. Microbiol. 14: 58-60, 1992. Bumpus JA. Biodegradation of polycyclic hydrocarbons by Phanerochaete chrysosporium. Appl. Environ. Microbiol. 55: 154-158, 1989. PubMed: 2705768 Yadav JS, Reddy CA. Degradation of benzene, toluene, ethylbenzene, and xylenes (BTEX) by the lignin-degrading basidiomycete Phanerochaete chrysosporium. Appl. Environ. Microbiol. 59: 756-762, 1993. PubMed: 8481002 Lewandowski GA, et al. Reactor design for hazardous waste treatment using a white rot fungus. Water Res. 24: 75-82, 1990. Wood JD, Wood PM. Evidence that cellobiose:quinone oxidoreductase from Phanerochaete chrysosporium is a breakdown product of cellobiose oxidase. Biochim. Biophys. Acta 1119: 90-96, 1992. PubMed: 1540640 Burdsall HH Jr., Eslyn WE. A new Phanerochaete with a Chrysosporium imperfect state. Mycotaxon 1: 123-133, 1974. Capalash N, Sharma P. Biodegradation of textile azo-dyes by Phanerochaete chrysosporium. World J. Microbiol. Biotechnol. 8: 309-312, 1992. Covert SF, et al. Genomic organization of a cellulase gene family in Phanerochaete chrysosporium published erratum appears in Curr. Genet. 23: 374, 1993. Curr. Genet. 22: 407-413, 1992. PubMed: 1423728 Fukai H, et al. Dechlorination and detoxification of bleach plant effluent by Phanerochaete chrysosporium. J Biotechnol 24: 267-275, 1992. Armenante PM, et al. Mineralization of 2-chlorophenol by Phanerochaete chrysosporium using different reactor designs. Hazard. Waste Hazard. Mater. 9: 213-229, 1992. Muheim A, et al. Purification and properties of an aryl-alcohol dehydrogenase from the white-rot fungus Phanerochaete chrysosporium. Eur. J. Biochem. 195: 369-375, 1991. PubMed: 1997322 Sayadi S, Ellouz R. Decolourization of olive mill waste-waters by the white-rot fungus Phanerochaete chrysosporium: involvement of the lignin-degrading system. Appl. Microbiol. Biotechnol. 37: 813-817, 1992. Pal N, et al. Process optimization and modeling of trichlorophenol degradation by Phanerochaete chrysosporium. Biotechnol. Bioeng. 46: 599-609, 1995. Rogalski J, Dawidowicz AL, Wojtas-Wasilewska M. Continuous production of ligin peroxidase by Phanerochaete chrysosporium immobilized on a sintered glass carrier. Acta Biotechnol. 12: 191-201, 1992. Kirby N, et al. Decolourisation of an artificial textile effluent by Phanerochaete chrysosporium. Biotechnol. Lett. 17: 761-764, 1995. Chao WL, Lee SL. Decoloration of azo dyes by three white-rot fungi: influence of carbon source. World J. Microbiol. Biotechnol. 10: 556-559, 1994. Bumpus JA, Aust SD. Biodegradation of DDT 1,1,1-trichloro-2,2-bis(4-chlorophenyl)ethane by the white rot fungus Phanerochaete chrysosporium. Appl. Environ. Microbiol. 53: 2001-2008, 1987. PubMed: 3674869 Mileski GJ, et al. Biodegradation of pentachlorophenol by the white rot fungus Phanerochaete chrysosporium. Appl. Environ. Microbiol. 54: 2885-2889, 1988. PubMed: 3223759 Fernando T, et al. Biodegradation of TNT (2,4,6-trinitrotoluene) by Phanerochaete chrysosporium. Appl. Environ. Microbiol. 56: 1666-1671, 1990. PubMed: 2383008 Dhawale SW, et al. Degradation of phenanthrene by Phanerochaete chrysosporium occurs under ligninolytic as well as nonligninolytic conditions. Appl. Environ. Microbiol. 58: 3000-3006, 1992. PubMed: 1444413 Dobozi MS, et al. Xylanase activity of Phanerochaete chrysosporium. Appl. Environ. Microbiol. 58: 3466-3471, 1992. Paszczynski A, et al. Mineralization of sulfonated azo dyes and sulfanilic acid by Phanerochaete chrysosporium and Streptomyces chromofuscus. Appl. Environ. Microbiol. 58: 3598-3604, 1992. PubMed: 1482182 Pasti-Grigsby MB, et al. Influence of aromatic substitution patterns on azo dye degradability by Streptomyces spp. and Phanerochaete chrysosporium. Appl. Environ. Microbiol. 58: 3605-3613, 1992. PubMed: 1482183 Camarero S, et al. Preferential degradation of phenolic lignin units by two white rot fungi. Appl. Environ. Microbiol. 60: 4509-4516, 1994. PubMed: 7811086 Bogan BW, Lamar RT. One-electron oxidation in the degradation of creosote polycyclic aromatic hydrocarbons by Phanerochaete chrysosporium. Appl. Environ. Microbiol. 61: 2631-2635, 1995. PubMed: 7618875 Hatakka A. Lignin-modifying enzymes from selected white-rot fungi: production and role in lignin degradation. FEMS Microbiol. Rev. 13: 125-135, 1994. Tuisel H, et al. Lignin peroxidase H2 from Phanerochaete chrysosporium: purification, characterization and stability to temperature and pH. Arch. Biochem. Biophys. 279: 158-166, 1990. PubMed: 2337347 Kersten PJ. Glyoxal oxidase of Phanerochaete chrysosporium: its characterization and activation by lignin peroxidase. Proc. Natl. Acad. Sci. USA 87: 2936-2940, 1990. PubMed: 11607073 Thomas DR, et al. Mineralization of biphenyl and PCBs by the white rot fungus Phanerochaete chrysosporium. Biotechnol. Bioeng. 40: 1395-1402, 1992. Constam D, et al. Purification and partial characterization of an intracellular NADH:quinone oxidoreductase from Phanerochaete chrysosporium. J. Gen. Microbiol. 137: 2209-2214, 1991. Katayama A, Matsumura F. Photochemically enhanced microbial degradation of environmental pollutants. Environ. Sci. Technol. 25: 1329-1333, 1991. Sublette KL, et al. Degradation of munition wastes by Phanerochaete chrysosporium. Appl. Biochem. Biotechnol. 34/35: 709-723, 1992. Hickey WJ, et al. Transformation of atrazine in soil by Phanerochaete chrysosporium. Soil Biol. Biochem. 26: 1665-1671, 1994. ASTM International Standard Test Methods for Ability of Adhesive Films to Support or Resist the Growth of Fungi. West Conshohocken, PA:ASTM International;ASTM Standard Test Method D 4300-01. ASTM International Standard Test Methods for Resistance of Adhesive Preparations in Container to Attack by Bacteria, Yeast, and Fungi. West Conshohocken, PA:ASTM International;ASTM Standard Test Method D 4783-01e1. Palma C, et al. Enhanced catalytic properties of MnP by exogenous addition of manganese and hydrogen peroxide. Biotechnol. Lett. 19: 263-267, 1997. May R, et al. Ex-situ process for treating PAH-contaminated soil with Phanerochaete chrysosporium. Environ. Sci. Technol. 31: 2626-2633, 1997. Moreira MT, et alEffect of pulsation on morphology of Aspergillus niger and Phanerochaete chrysosporium in a fluidized-bed reactorIn: Moreira MT, et alImmobilized cells: basics and applicationsAmsterdamElsevierpp. 518-523, 1996 Hawari J, et al. Biotransformation of 2,4,6-trinitrotoluene with Phanerochaete chrysosporium in agitated cultures ot pH 4.5. Appl. Environ. Microbiol. 65: 2977-2986, 1999. PubMed: 10388692 Krcmar P, et al. Degradation of polychlorinated biphenyls by extracellular enzymes of Phanerochaete chrysosporium produced in a perforated plate bioreactor. World J. Microbiol. Biotechnol. 15: 237-242, 1999. Janshekar H, et al. Fungal degradation of pine and straw alkali lignins. Eur. J. Appl. Microbiol. Biotechnol. 14: 174-181, 1982. Arjmand M, Sandermann H Jr.. N-(Chlorophenyl)-succinimides, a novel metabolite class isolated from Phanerochaete chrysosporium. Pestic. Biochem. Physiol. 27: 173-181, 1987. Farrell RL, et al. Physical and enzymatic properties of lignin peroxidase isoenzymes from Phanerochaete chrysosporium. Enzyme Microb. Technol. 11: 322-328, 1989. Galeno G, Agosin E. Screening of white-rot fungi for efficient decolourization of bleach pulp effluents. Biotechnol. Lett. 12: 869-872, 1990. Morgan P, et al. Growth and biodegradation by white-rot fungi inoculated into soil. Soil Biol. Biochem. 25: 279-287, 1993. type strain of Sporotrichum pulverulentum Fratila-Apachitei LE, et al. Diuron degradation by Phanerochaete chrysosporium BKM-F-1767 in synthetic and natural media. Biotechnol. Lett. 21: 147-154, 1999. Stewart P, Gaskell J, Cullen D. A homokaryotic derivative of a Phanerochaete chrysosporium strain and its use in genomic analysis of repetitive elements. Appl Environ Microbiol. 66: 1629-1633, 2000. Doddapaneni H, Chakraborty R, Yadav JS. Genome-wide structural and evolutionary analysis of the P450 monooxygenase genes (P450ome) in the white rot fungus Phanerochaete chrysosporium: evidence for gene duplications and extensive gene clustering. BMC Genomics 6: 92, 2005. Subramanian V, et al. P450 redox enzymes in the white rot fungus Phanerochaete chrysosporium: gene transcription, heterologous expression, and activity analysis on the purified proteins. Curr. Microbiol. 61: 306-314, 2010. PubMed: 20221604 Doddapaneni H, Yadav JS. Microarray-based global differential expression profiling of P450 monooxygenases and regulatory proteins for signal transduction pathways in the white rot fungus Phanerochaete chrysosporium. Mol. Genet. Genomics 274: 454-466, 2005. PubMed: 16231151 Doddapaneni H, Subramanian V, Yadav JS. Physiological regulation, xenobiotic induction, and heterologous expression of P450 monooxygenase gene pc-3 (CYP63A3), a new member of the CYP63 gene cluster in the white-rot fungus Phanerochaete chrysosporium. Curr Microbiol 50: 292-298, 2005. PubMed: 15968506 Syed K, et al. Genome-to-function characterization of novel fungal P450 monooxygenases oxidizing polycyclic aromatic hydrocarbons (PAHs). Biochem. Biophys. Res. Commun. 399: 492-497, 2010. PubMed: 20674550 type strain of Sporotrichum pulverulentum |