| 产品名称: | Aspergillus oryzae (Ahlburg) Cohn |
|---|---|
| 商品货号: | TS167300 |
| Deposited As: | Aspergillus oryzae var. viridis Murakami |
| Strain Designations: | RIB40 |
| Application: | Produces acetamidase
Produces acid protease protease (acid)
Produces glucoamylase
Produces taka-amylase A
Cloning of the taka-amylase A gene
Cloning of the acetamidase gene
Cloning of the acid protease-encoding gene DDBJ D13894 |
| Biosafety Level: | 1
Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country. |
| Product Format: | freeze-dried |
| Storage Conditions: | Frozen: -80°C or colder Freeze-Dried: 2°C to 8°C Live Culture: See Propagation Section |
| Type Strain: | no |
| Preceptrol®: | no |
| Genome Sequenced Strain: | Yes |
| Comments: | Genome sequencing strain (National Institute of Technology and Evaluation (NITE), Japan). |
| Medium: | ATCC® Medium 200: YM agar or YM broth ATCC® Medium 312: Czapeks agar ATCC® Medium 336: Potato dextrose agar (PDA) |
| Growth Conditions: | Temperature: 24°C to 26°C
Atmosphere: Typical aerobic |
| Sequenced Data: |
18S ribosomal RNA gene, partial sequence; internalxa0xa0 transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence.
GGTTTCCGTAGGTGAACCTGCGGAAGGATCATTACCGAGTGTAGGGTTCCTAGCGAGCCCAACCTCCCACCCGTGTTTACTGTACCTTAGTTGCTTCGGCGGGCCCGCCATTCATGGCCGCCGGGGGCTCTCAGCCCCGGGCCCGCGCCCGCCGGAGACACCACGAACTCTGTCTGATCTAGTGAAGTCTGAGTTGATTGTATCGCAATCAGTTAAAACTTTCAACAATGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAACTAGTGTGAATTGCAGAATTCCGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTGCTGCCCATCAAGCACGGCTTGTGTGTTGGGTCGTCGTCCCCTCTCCGGGGGGGACGGGCCCCAAAGGCAGCGGCGGCACCGCGTCCGATCCTCGAGCGTATGGGGCTTTGTCACCCGCTCTGTAGGCCCGGCCGGCGCTTGCCGAACGCAAATCAATCTTTTTCCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAA D1D2 region of the 28S ribosomal RNA gene ATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAAGAGCTCAAATTTGAAAGCTGGCTCCTTCGGGGTCCGCATTGTAATTTGCAGAGGATGCTTCGGGTGCGGCCCCTGTCTAAGTGCCCTGGAACGGGCCGTCAGAGAGGGTGAGAATCCCGTCTGGGATGGGGTGTCCGCGCCCGTGTGAAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATACTGGCCGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCGACCAGACTCGCCTCCAGGGTTCAGCCGGCATTCGTGCCGGTGTACTTCCCTGGGGGCGGGCCAGCGTCGGTTTGGGCGGCCGGTCAAAGGCTCCCGGAATGTAGTGCCCTCCGGGGCACCTTATAGCCGGGAGTGCAATGCGGCCAGCCTGGACCGAGGAACGCGCTTCGGCACGGACGCTGGCATAATGGTCGTAAACGAC |
| Name of Depositor: | K Nojiro |
| Chain of Custody: | ATCC <-- K Nojiro <-- H. Murakami |
| Isolation: | Cereal |
| Cross References: | Nucleotide (GenBank) : KU729047 ITS including 5.8S rRNA gene Nucleotide (GenBank) : KU729135 D1/D2 region of 28S rRNA gene Nucleotide (GenBank) : D63941 Aspergillus oryzae enoA gene for enolase, complete cds. enolase (= phophopyruvate hydratase) gene, enoA Nucleotide (GenBank) : E03046 DNA sequence coding for glyceraldehyde-3-phosphate dehydrogenase derived from Aspergillus oryzae. Nucleotide (GenBank) : JZJM00000000 Aspergillus oryzae RIB40, whole genome shotgun sequencing project |
| References: | Gomi K, et al. Cloning and nucleotide sequence of the acid protease-encoding gene (pepA) from Aspergillus oryzae. Biosci. Biotechnol. Biochem. 57: 1095-1100, 1993. PubMed: 7763981 Gomi K, et al. Cloning and molecular characterization of the acetamidase-encoding gene (amdS) from Aspergillus oryzae. Gene 108: 91-98, 1991. PubMed: 1840550 Machida M, et al. Molecular cloning of a genomic DNA for enolase from Aspergillus oryzae. Biosci. Biotechnol. Biochem. 60: 161-163, 1996. PubMed: 8824839 Tada S, et al. Cloning and nucleotide sequence of the genomic Taka-amylase A gene of Aspergillus oryzae. Agric. Biol. Chem. 53: 593-599, 1989. Nagashima T, et al. Site-directed mutagenesis of catalytic active-site residues of Taka-amylase A. Biosci. Biotech. Biochem. 56: 207-210, 1992. Razzaque A, Ueda S. Glucoamylase of Aspergillus oryzae. J. Ferment. Technol. 56: 296-302, 1978. Machida M, et al. Genome sequencing and analysis of Aspergillus oryzae. Nature 438: 1157-1161, 2005. Wang H, et al. A fungal phylogeny based on 82 complete genomes using the composition vector method. BMC Evol. Biol. 9: 195, 2009. PubMed: 19664262 Akao T, et al. Analysis of expressed sequence tags from the fungus Aspergillus oryzae cultured under different conditions. DNA Res. 14: 47-57, 2007. PubMed: 17540709 Ito K, Hanya Y, Koyama Y. Purification and characterization of a glutaminase enzyme accounting for the majority of glutaminase activity in Aspergillus sojae under solid-state culture. Appl. Microbiol. Biotechnol. 97: 8581-8590, 2013. PubMed: 23339014 Kuprys PV, et al. Identification of telomerase RNAs from filamentous fungi reveals conservation with vertebrates and yeasts. PLoS One 8: e58661, 2013. PubMed: 23555591 Yanagisawa S, Kikuma T, Kitamoto K. Functional analysis of Aoatg1 and detection of the Cvt pathway in Aspergillus oryzae. FEMS Microbiol Lett 338: 168-176, 2013. PubMed: 23136971 Akao T, et al. Lack of endoplasmic reticulum 1,2-alpha-mannosidase activity that trims N-glycan Man9GlcNAc2 to Man8GlcNAc2 isomer B in a manE gene disruptant of Aspergillus oryzae. J. Biosci. Bioeng. 113: 438-441, 2012. PubMed: 22169093 Ogawa M, Kobayashi T, Koyama Y. ManR, a novel Zn(II)2Cys6 transcriptional activator, controls the beta-mannan utilization system in Aspergillus oryzae. Fungal Genet. Biol. 49: 987-995, 2012. PubMed: 23063954 Marui J, et al. Enzymatic properties of the glycine D-alanine corrected aminopeptidase of Aspergillus oryzae and its activity profiles in liquid-cultured mycelia and solid-state rice culture (rice koji). Appl. Microbiol. Biotechnol. 93: 655-669, 2012. PubMed: 22005737 Joardar V, et al. Sequencing of mitochondrial genomes of nine Aspergillus and Penicillium species identifies mobile introns and accessory genes as main sources of genome size variability. BMC Genomics 13: 698, 2012. PubMed: 23234273 Kikuma T, Kitamoto K. Analysis of autophagy in Aspergillus oryzae by disruption of Aoatg13, Aoatg4, and Aoatg15 genes. FEMS Microbiol. Lett. 316: 61-69, 2011. PubMed: 21204928 Tokunaga C, Saitoh C, Kitamoto K. Cloning of Aspergillus oryzae Aovps5 gene, homologous to vacuolar protein sorting associated gene VPS5 and construction of the disruptant. J. Biosci. Bioeng. 108: 121-123, 2009. PubMed: 19619858 Ogasawara H, et al. Crawler, a novel Tc1/mariner-type transposable element in Aspergillus oryzae transposes under stress conditions. Fungal Genet. Biol. 46: 441-449, 2009. PubMed: 19269345 Higuchi Y, et al. Endocytosis is crucial for cell polarity and apical membrane recycling in the filamentous fungus Aspergillus oryzae. Eukaryot. Cell 8: 37-46, 2009. PubMed: 19028995 Escano CS, et al. Disruption of the Aopex11-1 gene involved in peroxisome proliferation leads to impaired Woronin body formation in Aspergillus oryzae. Eukaryot. Cell 8: 296-305, 2009. PubMed: 19136573 Shima Y, et al. Identification of three mutant loci conferring carboxin-resistance and development of a novel transformation system in Aspergillus oryzae. Fungal Genet. Biol. 46: 67-76, 2009. PubMed: 18992352 |