| 产品名称: | Komagataella phaffii Kurtzman |
|---|---|
| 商品货号: | TS169213 |
| Deposited As: | Komagataella pastoris |
| Strain Designations: | NRRL Y-11430 21-1, CBS 7435 |
| Application: | Produces alcohol oxidase. Produces single-cell protein SCP. |
| Biosafety Level: | 1
Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country. |
| Product Format: | freeze-dried |
| Storage Conditions: | Frozen: -80°C or colder Freeze-Dried: 2°C to 8°C Live Culture: See Propagation Section |
| Type Strain: | no |
| Preceptrol®: | no |
| Genome Sequenced Strain: | Yes |
| Comments: | Genome sequencing strain (The Institute of Molecular Biotechnology, Graz University of Technology, Austria).
Mitochondrial genome sequenced (The Institute of Molecular Biotechnology, Graz University of Technology, Austria). |
| Morphology: | On YM medium at 25°C after 8 days, colonies creamy white, butyrous, dull, smooth, margin entire. Cells hyaline, globose to subglobose, smooth, 3-7 X 3-6 µm. Pseudohyphae not observed. |
| Medium: | ATCC® Medium 28: Emmons modification of Sabourauds agar ATCC® Medium 200: YM agar or YM broth ATCC® Medium 1245: YEPD |
| Growth Conditions: | Temperature: 24°C to 26°C
Atmosphere: Typical aerobic |
| Sequenced Data: |
Internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence
TAAATCTCCTCCCAACGGATCTCTTGGCTCTCGCGACGATGAAGAACGCAGCGATCCGCGATACGTCCTGGAAGCCGCCGTGAACCATCAATTTTCGAACGCACATTGCATACAGGGAGGGTGGGGTGAGTCTACTCTCACTATCGTGGTTTAAATACAAAGGATGACTAATACAATCGTCAGCCCCCAAATTTTCTCCCCCGCCCCCTCAGATTACCCGCTGAACTTAAGCATATCAATAA D1D2 region of the 26S ribosomal RNA gene ATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAAAAGTCCACCTTTGAAGTATTGACGTGGTTGGGAGAGGCAATGTGCACAAGTCGCCTGGAACGGCCGCCAAAGAGGGTGATAGCCCCGTAGCACGGTCAACCTTCCCAGCCGACAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAAGGTGGTAGGGTCCATCAAAGACTAAATATCAGCGAGAGACCGATAGCAAACAAGTACAGTGATGGAAAGATGAAAAGAACTTTGAAAAGAGAGTGAAACAGTGCGTGAAATTGGGGGGAGGGAAGGCAAGGCCACGACAAGTGGTCCTGCGC |
| Name of Depositor: | NRRL |
| Chain of Custody: | ATCC |
| References: | Wegner EH. Biochemical conversions by yeast fermentation at high cell densities. US Patent 4,617,274 dated Oct 14 1986 Hopkins TR. Alcohol oxidase from Pichia-type yeasts. US Patent 4,619,898 dated Oct 28 1986 Kuberl A, et al. High-quality genome sequence of Pichia pastoris CBS7435. J. Biotechnol. 20;154(4): 312-320,2011. PubMed: 21575661 Kurtzman CP. Biotechnological strains of Komagataella (Pichia) pastoris are Komagataella phaffii as determined from multigene sequence analysis. J Ind Microbiol Biotechnol 36: 1435-1438, 2009. PubMed: 19760441 |