微信小陈
微信小章| 产品名称： | Aspergillus pachycristatus Matsuzawa et al. |
|---|---|
| 商品货号： | TS169469 |
| Deposited As： | Aspergillus nidulans var. roseus Boeck et Kastner |
| Strain Designations： | NRRL 11440 A42355 |
| Application： | produces A30912 produces echinocandin B produces sterigmatocystin |
| Biosafety Level： | 1
Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country. |
| Product Format： | freeze-dried |
| Storage Conditions： | Frozen: -80°C or colder Freeze-Dried: 2°C to 8°C Live Culture: See Propagation Section |
| Type Strain： | no |
| Preceptrol®： | no |
| Comments： | This fungus was re-identified as Aspergillus pachycristatus based on the multigene sequence analysis |
| Morphology： | After 6 days on Potato dextrose medium at 25°C, colony velutinous, buff and green, reverse red-orange. Conidiophores with short stipes, vesicles globose, biseriate, with phialides only on the upper half of the vesicles. Conidia green, subglobose, smooth-walled. Ascospores red, lenticular, with flanges. Globose Hülle cells abundant. |
| Medium： | ATCC® Medium 325: Malt extract agar (Blakeslees formula) ATCC® Medium 336: Potato dextrose agar (PDA) |
| Growth Conditions： | Temperature: 24°C to 26°C Atmosphere: Typical aerobic |
| Sequenced Data： |
D1D2 region of the 28S ribosomal RNA gene ATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAAGAGCTCAAATTTGAAAGCTGGCCCCTTCGGGGTCCGCGTTGTAATTTGCAGAGGATGCTTCGGGTGCGGCCCCTGTCTAAGTGCCCTGGAACGGGCCGTCAGAGAGGGTGAGAATCCCGTCTTGGGCAGGGTGCCCGTGCCCGTGTGAAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATACCGGCCGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCGACCAGACTCGGCCCCGGGGTTCAGCCAGCACTCGTGCTGGTGTACTTCCCCGGGGGCGGGCCAGCGTCGGTTTGGGCGGCCGGTCAAAGGCCCCAGGAATGTATCGCCCTCCGGGGTTGTCTTATAGCCTGGGGTGCAATGCGGCCAGCCCGGACCGAGGAACGCGCTTCGGCACGGACGCTGGCGTAATGGTCGCAAACGAC Calmodulin gene GTTTGTAAGTGCCATTGGTTATTGTTATATCAAATTCGAATTTATATTGAGAGTATACTAATTTATTCCGCGCTTAACAGGACAAGGATGGCGATGGTTAGTGCATTTGTCCCCCCAGACCTGATCGCATTCGCCCAGCGTGTCTGCTGTAGTTCTATATAAACCGATTCTGATAAACGGCGACAGGCCAGATTACCACTAAGGAGCTTGGCACTGTCATGCGCTCGCTCGGTCAGAATCCTTCAGAGTCTGAACTTCAGGACATGATCAACGAAGTTGACGCCGACAACAATGGCACCATCGACTTCCCAGGTACGCGATCTCCCGATCTACTTCTCAGCAAGCTAGAAACTGTACTAATGATAAACAGAGTTCCTTA |
| Name of Depositor： | NRRL |
| Chain of Custody： | ATCC <-- NRRL <-- Eli Lilly & Co. A42355 |
| Isolation： | Soil, Indiana, USA |
| References： | Boeck LD, Kastner RE. Method of producing the A-30912 antibiotics. US Patent 4,288,549 dated Sep 8 1981 Branch KR, Bennett JW, Bhatnagar D. Sterigmatocystin production by Aspergillus nidulans. Fungal Genet Newsl 40: 20-21, 1993. Hodges RL, et al. Genetic modification of an echinocandin B-producing strain of Aspergillus nidulans to produce mutants blocked in sterigmatocystin biosynthesis. J. Ind. Microbiol. 13: 372-381, 1994. PubMed: 7765669 Tóth V, et al. The echinocandin B producer fungus Aspergillus nidulans var. roseus TS169469 does not possess innate resistance against its lipopeptide antimycotic. Appl. Microbiol. Biotechnol., in press, 2012. PubMed: 22555909 Cacho RA, et al. Identification and characterization of the echinocandin B biosynthetic gene cluster from Emericella rugulosa NRRL 11440. J Am Chem Soc 134: 16781-16790, 2012. PubMed: 22998630 Toth V, et al. Polyphasic characterization of "Aspergillus nidulans var. roseus" TS169469. Folia Microbiol 56: 381-388, 2011. PubMed: 21858538 |