| 产品名称: | Septobasidium burtii Lloyd |
|---|---|
| 商品货号: | TS172190 |
| Strain Designations: | ECS 7 MIN 878588 |
| Biosafety Level: | 1
Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country. |
| Product Format: | frozen |
| Storage Conditions: | Frozen: -80°C or colder Freeze-Dried: 2°C to 8°C Live Culture: See Propagation Section |
| Type Strain: | no |
| Preceptrol®: | no |
| Comments: | Reference strain for AFTOL (Assembling the Fungal Tree of Life) project. |
| Medium: | ATCC® Medium 28: Emmons modification of Sabourauds agar ATCC® Medium 200: YM agar or YM broth ATCC® Medium 336: Potato dextrose agar (PDA) |
| Growth Conditions: | Temperature: 25°C
Atmosphere: Typical aerobic |
| Sequenced Data: |
ITS DNA sequence of MYA-4635 AGGATCATTAGTGAATTTGTTGGATTTCTAATCCACACTCTCTCACTTTCTAACCCTGTGAACTTATTATAAAATGGCATTTGAATGTTAACGCGTTCGTTTGTTGTTTTTTATATTATAAACTTAGTAAAGTTGAAGAATGTATTTTTTTATAACAAATAAAAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAATTGCGATAAGTAATGTGAATTGCAGAATTCAGTGAACCATCGAATCTTTGAACGCACCTTGCACTCTTTGGTATTCCGAAGAGTATGCCTGTTTGAGTGTTATGAAATCTCTCAACCTATCATTTTTCATTAGAACTTTGATTAGGATTGGATTCTGAACGTTGCTGACTAGTTTACTAGTGGAGCTCGTTTGAAATAGAATAGCAAATGTCTGATCTTTAATCGGTTTGACTTGGCGTAATAAGTAACATTTCGCTAAGGATTATCCTCTGGGTAACCGAATTTTGTATTAATGACTTGCTTCTAAATCTTAATTTTCTAATTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAAT |
| Name of Depositor: | MC Aime |
| Special Collection: | ATCC |
| Chain of Custody: | ATCC |
| Cross References: | Nucleotide (GenBank) : GU291279 ITS including 5.8S rRNA gene |
| References: | Hibbett DS, et al. A higher level phylogenetic classification of the Fungi. Mycol. Res. 111: 509-547, 2007. PubMed: 17572334 Aime MC, et al. An overview of the higher level classification of Pucciniomycotina based on combined analyses of nuclear large and small subunit rDNA sequences. Mycologia 98: 896-905, 2006. PubMed: 17486966 McLaughlin DJ, et al. Mitosis in the yeast phase of the basidiomycetes Bensingtonia yuccicola and Stilbum vulgare and its phylogenetic implications. Am. J. Bot. 91: 808-815, 2004. PubMed: 21653436 |