微信小陈
微信小章| 产品名称： | Aurantiochytrium limacinum (Honda et Yokochi) Yokoyama et Honda |
|---|---|
| 商品货号： | TS174345 |
| Deposited As： | Schizochytrium limacinum Honda et Yokochi |
| Strain Designations： | SR21 IFO 32693 |
| Application： | Produces docosahexaenoic acids Produces docosapentaenoic acid Biofuel production |
| Biosafety Level： | 1
Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country. |
| Product Format： | frozen |
| Storage Conditions： | Frozen: -80°C or colder Freeze-Dried: 2°C to 8°C Live Culture: See Propagation Section |
| Type Strain： | yes |
| Preceptrol®： | no |
| Genome Sequenced Strain： | Yes |
| Comments： | ITS DNA sequencing results suggest that the strain likely has different rDNA operons, or the ITS sequence of this strain has unique features that make conventional DNA seqencing difficult.
Genome sequencing strain (the Joint Genome Institute at the Department of Energy, USA).
Schizochytrium limacinum has been renamed as Aurantiochytrium limacinum by Yokoyama and Honda (2007) based on the 18S rRNA gene phylogeny and other characteristics. |
| Medium： | ATCC® Medium 790: By+ medium ATCC® Medium 633: M3 chytrid agar ATCC® Medium 683: Kochs K-1 medium |
| Growth Conditions： | Temperature: 18°C to 22°C Atmosphere: Typical aerobic |
| Sequenced Data： |
Partial sequence of 18S ribosomal RNA gene, 5’ end GTGTAAGTATAAGCGATTGTACTGTGAGACTGCGAACGGCTCATTATATCAGTAATAATTTCTTCGGTAGTTTCTTTTATATGGATACCTGCAGTAATTCTGGAAATAATACATGCTGTAAGAGCCCTGTATGGGGCTGCACTTATTAGATTGAAGCCGATTTTATTGGTGAATCATGATAATTGAGCAGATTGACTTTTTGGTCGATGAATCGTTTGAGTTTCTGCCCCATCAGTTGTCGACGGTAGTGTATTGGACTACGGTGACTATAACGGGTGACGGAGAGTTAGGGCTCGACTCCGGAGAGGGAGCCTGAGAGACGGCTACCATATCCAAGGATAGCAGCAGGCGCGTAAATTACCCACTGTGGACTCCACGAGGTAGTGACGAGAAATATCGATGCGAAGCGTGTATGCGTTTTGCTATCGGAATGAGAGCAATGTAAAACCCTCATC Partial sequence of 18S ribosomal RNA gene, 3’ end TGGAATTGAGTGCTTGGTCGGAAGGCCTGGCTAATCCTTGGAACGCTCATCGTGCTGGGGCTAGATTTTTGCAATTATTAATCTCCAACGAGGAATTCCTAGTAAACGCAAGTCATCAGCTTGCATTGAATACGTCCCTGCCCTTTGTACACACCGCCCGTCGCACCTACCGATTGAACGGTCCGATGAAACCATGGGATGTTTCTGTTTGGATTAATTTTTGGACAGAGGCAGAACTCGGGTGAATCTTATTGTTTAGAGGAAGG |
| Name of Depositor： | T Nakahara |
| Special Collection： | NCRR Contract |
| Chain of Custody： | ATCC |
| Isolation： | Seawater in mangrove area, Colonia, Yap Islands, Micronesia |
| Cross References： | Nucleotide (GenBank) : AB022107 gene for 18S rRNA |
| References： | Honda D, et al. Molecular phylogeny of labyrinthulids and thraustochytrids based on the sequencing of 18S ribosomal RNA gene. J. Eukaryot. Microbiol. 46: 637-647, 1999. PubMed: 10568038 Yokochi T, et al. Optimization of docosahexaenoic acid production by Schizochytrium limacinum SR21. Appl. Microbiol. Biotechnol. 49: 72-76, 1998. Honda D, et al. Schizochytrium limacinum sp. nov., a new thraustochytrid from a mangrove area in the west Pacific Ocean. Mycol. Res. 102: 439-448, 1998. Nakahara T, et al. Production of docosahexaenoic and docosapentaenoic acids by Schizochytrium sp. isolated from Yap Islands. J. Am. Oil Chem. Soc. 73: 1421-1426, 1996. Ye C, et al. Reconstruction and analysis of the genome-scale metabolic model of Schizochytrium limacinum SR21 for docosahexaenoic acid production. BMC Genomics 16: 799, 2015. PubMed: 26475325 Liang Y, et al. Fermentable sugar release from Jatropha seed cakes following lime pretreatment and enzymatic hydrolysis. Bioresour Technol 101: 6417-6424, 2010. PubMed: 20417097 Liang Y, et al. Batch stage study of lipid production from crude glycerol derived from yellow grease or animal fats through microalgal fermentation. Bioresour Technol 101: 6745-6750, 2010. PubMed: 20381345 Liang Y, et al. Use of sweet sorghum juice for lipid production by Schizochytrium limacinum SR21. Bioresour Technol 101: 3623-3627, 2010. PubMed: 20079633 Chi Z, et al. Study of a two-stage growth of DHA-producing marine algae Schizochytrium limacinum SR21 with shifting dissolved oxygen level. Appl Microbiol Biotechnol 81: 1141-1148, 2009. PubMed: 18936938 Chi Z, et al. Production of omega-3 polyunsaturated fatty acids from cull potato using an algae culture process. Appl Biochem Biotechnol 137: 805-815, 2007. PubMed: 18478436 Miyamoto E, et al. Occurrence of 5-deoxyadenosylcobalamin and its physiological function as the coenzyme of methylmalonyl-CoA mutase in a marine eukaryotic microorganism, Schizochytrium limacinum SR21. J Nutr Sci Vitaminol 53: 471-475, 2007. PubMed: 18202533 Morita E, et al. Docosahexaenoic acid production and lipid-body formation in Schizochytrium limacinum SR21. Mar Biotechnol 8: 319-327, 2006. PubMed: 16763939 Yokoyama R, Honda D. Taxonomic rearrangement of the genus Schizochytrium sensu lato based on morphology, chemotaxonomic characteristics, and 18S rRNA gene phylogeny (Thraustochytriaceae, Labyrinthulomycetes): emendation for Schizochytrium and erection of Aurantiochytrium and Oblongichytrium gen. nov. Mycoscience 48:199-211, 2007. |