| 产品名称: | pHSY15 |
|---|---|
| 商品货号: | TS175411 |
| Designations: | pHSY15 |
| GenBank Number: | M97655 |
| Species: | Homo sapiens, human |
| Vector: | Construct size (kb): 3.299999952316284 DESCRIPTION OF VECTOR COMPONENT: Name of vector: pUC18 Intact vector size: 2.686 Type of vector: plasmid Vector end: BamHI Vector end: EcoRI Cloning sites: HindIII SphI PstI SalI AccI HincII XbaI BamHI SmaI KpnI SacI EcoRI Polylinker sites: HindIII SphI PstI SalI AccI HincII XbaI BamHI SmaI KpnI SacI EcoRI Construction: pUC71K Host range: Escherichia coli Features (with orientation and position when available): insert detection: lacZ, MCS: HindIII...EcoRI, -> promoter: lac, replicon: pMB1, marker(s): ampR, Cross references: DNA Seq. Acc.: L08752 |
| Insert: | DNA: cDNA DESCRIPTION OF INSERT COMPONENT: Genome: Homo sapiens Gene symbol: PTS Genomic copy number: unique Gene name: 6-pyruvoyltetrahydropterin synthase Contains complete coding sequence?: Y Chromosome: 11; Localization: 11 q22.3-q23.3 Tissue: liver Type of DNA: cDNA Insert 5 end: BamHI Insert 3 end: EcoRI Insert size (kb): 0.635 Cross references: DNA Seq. Acc.: M97655 Insert lengths(kb): 0.6349999904632568 Tissue: liver Gene product: 6-pyruvoyltetrahydropterin synthase PTS |
| Insert Size (kb): | 0.635 |
| Biosafety Level: | 1
Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country. |
| Shipping Information: | Distributed: DNA (dried). Rehydrate with TE. (amount: 200 ng) |
| Comments: | Restriction digests of the clone give the following sizes (kb): BamHI/EcoRI--2.7, 0.65; BglI--2.2, 1.15; HindIII--3.35; PstI--3.35; PvuII--2.35, 1.0. Contains the complete coding sequence (nt 8-439). Constructed by amplification using the following primers incorporating BamHI and EcoRI sites: PTPS11-5CGGGATCCATATGAGCACGGAAGGTGGTG 3 and PTPS14-5CGGAATTCAGGATGTATATTACAAGTT 3. |
| References: | Thony B, et al. Human 6-pyruvoyltetrahydropterin synthase: cDNA cloning and heterologous expression of the recombinant enzyme. Biochem. Biophys. Res. Commun. 189: 1437-1443, 1992. PubMed: 1282802 Beat Thony, personal communication |