微信小陈
微信小章| 产品名称： | Candida albicans (Robin) Berkhout |
|---|---|
| 商品货号： | TS175833 |
| Strain Designations： | IOC 2023 2023, 582 (phase S), CBS 2718, CCY 29-3-108, FMJ 1011, IFO 1061 |
| Application： | Produces acid phosphatase
Produces aspartic proteinases aspartyl proteinases
Produces glucan 1,3-beta-glucosidase beta-D-1,3-glucanase, exo-1,3-beta-glucanase, exo-1,3-beta-glucosidase
Produces glutamate synthase
Produces hexosaminidase A (alpha polypeptide) Hexose aminidase A (alpha polypeptide), beta-N-acetylhexosaminidase, N-acetyl-beta-glucosaminidase
Produces trehalase
Transformation host |
| Biosafety Level： | 1
Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country. |
| Product Format： | freeze-dried |
| Storage Conditions： | Frozen: -80°C or colder Freeze-Dried: 2°C to 8°C Live Culture: See Propagation Section |
| Type Strain： | no |
| Antigenic Properties： | serotype A
Ref  Wagner T, et al. pH-dependent denaturation of extracellular aspartic proteinases from Candida species. J. Med. Vet. Mycol. 33: 275-278, 1995. PubMed: 8531028 |
| Preceptrol®： | no |
| Comments： | Adheres to oral streptococci
Characterization
Chitin synthesis
Lipid composition
Germ tube induction
Pathogenicity in mice
Effect of miconazole on plasma membrane |
| Medium： | ATCC® Medium 28: Emmons modification of Sabourauds agar ATCC® Medium 200: YM agar or YM broth ATCC® Medium 323: Malt agar medium |
| Growth Conditions： | Temperature: 24°C to 26°C Atmosphere: Typical aerobic |
| Sequenced Data： |
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence GGAAGGATCATTACTGATTTGCTTAATTGCACCACATGTGTTTTTCTTTGAAACAAACTTGCTTTGGCGGTGGGCCCAGCCTGCCGCCAGAGGTCTAAACTTACAACCAATTTTTTATCAACTTGTCACACCAGATTATTACTAATAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATATGAATTGCAGATATTCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTCTGGTATTCCGGAGGGCATGCCTGTTTGAGCGTCGTTTCTCCCTCAAACCGCTGGGTTTGGTGTTGAGCAATACGACTTGGGTTTGCTTGAAAGACGGTAGTGGTAAGGCGGGATCGCTTTGACAATGGCTTAGGTCTAACCAAAAACATTGCTTGCGGCGGTAACGTCTACCACGTATATCTTCAAACTTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATA |
| Name of Depositor： | AE de Area Leao |
| Chain of Custody： | ATCC |
| Cross References： | Nucleotide (GenBank) : Y09664 C.albicans EFT2 gene. Nucleotide (GenBank) : Y17007 Candida albicans PDC2 gene. Nucleotide (GenBank) : AJ012715 Candida albicans PET100 gene. Nucleotide (GenBank) : X56556 C.albicans XOG gene for exo-1,3-beta-glucanase. Nucleotide (GenBank) : U63297 Candida albicans Van1p (VAN1) gene, complete cds. Nucleotide (GenBank) : U63642 Candida albicans Mnn9p (MNN9) gene, complete cds. Nucleotide (GenBank) : U40704 Candida albicans catalase (Cat) gene, complete cds. Nucleotide (GenBank) : U15800 Candida albicans chitinase (cht2) gene, complete cds. Nucleotide (GenBank) : U15801 Candida albicans chitinase (cht3) gene, complete cds. Nucleotide (GenBank) : U36490 Candida albicans chitinase (CHT1) gene, complete cds. Nucleotide (GenBank) : X82017 nucleotide sequence of ribosomal protein 10 gene, rp10 Nucleotide (GenBank) : AY009150 Candida albicans chitinase (CHT4) gene, complete cds. Nucleotide (GenBank) : U12975 Candida albicans TS175833 beta-1,3 glucan transferase (BGL2) Nucleotide (GenBank) : U36754 Candida albicans vacuolar aspartic proteinase precursor (Apr1) Nucleotide (GenBank) : X94753 C.albicans GFA1 gene for fructose-6-phosphate amidotransferase. Nucleotide (GenBank) : Y17395 Candida albicans mRNA for origin recognition complex 1 protein. Nucleotide (GenBank) : M83663 Candida albicans secreted aspartyl proteinase gene, complete cds. Nucleotide (GenBank) : X16634 Candida albicans DNA of an autonomously replicating sequence (ARS) Nucleotide (GenBank) : U35070 integrin-like protein alpha Intlp (alpha INT1) gene, complete coding sequence |
| References： | Holmes AR, et al. Ammonium assimilation by Candida albicans and other yeasts: evidence for activity of glutamate synthase. J. Gen. Microbiol. 135: 1423-1430, 1989. PubMed: 2575653 Cutfield S, et al. Crystalization of the exo(1,3)-þ-glucanase from Candida albicans. J. Mol. Biol. 225: 217-218, 1992. PubMed: 1583691 Shepherd MG, et al. Germ tube induction in Candida albicans. Can. J. Microbiol. 26: 21-26, 1980. PubMed: 6996798 Wagner T, et al. pH-dependent denaturation of extracellular aspartic proteinases from Candida species. J. Med. Vet. Mycol. 33: 275-278, 1995. PubMed: 8531028 Chiew YY, et al. Regulation of chitin synthesis during germ-tube formation in Candida albicans. Arch. Microbiol. 125: 97-104, 1980. PubMed: 6446267 . . J. Bacteriol. 49: 317-334, 1945. Sundaram S, et al. Changes in lipid composition during starvation and germ-tube formation in Candida albicans. Exp. Mycol. 5: 140-147, 1981. Molloy C, et al. Differential extraction of N-acetylglucosaminidase and trehalase from the cell envelope of Candida albicans. Exp. Mycol. 19: 178-185, 1995. PubMed: 7553268 Chambers RS, et al. An exo-beta-(1,3)-glucanase of Candida albicans: purification of the enzyme and molecular cloning of the gene. J. Gen. Microbiol. 139: 325-334, 1993. PubMed: 8436950 . . J. Med. Microbiol. 14: 307-319, 1980. Swoboda RK, et al. Structure and regulation of a Candida albicans RP10 gene which encodes an immunogenic protein homologous to Saccharomyces cerevisiae ribosomal protein 10. J. Bacteriol. 177: 1239-1246, 1995. PubMed: 7868597 Lerner CG, Goldman RC. Stimuli that induce production of Candida albicans extracellular aspartyl proteinase. J. Gen. Microbiol. 139: 1643-1651, 1993. PubMed: 7690395 Ansari S, Prasad R. Effect of miconazole on the structure and function of plasma membrane of Candida albicans. FEMS Microbiol. Lett. 114: 93-98, 1993. PubMed: 8293965 Gale C, et al. Cloning and expression of a gene encoding an integrin-like protein in Candida albicans. Proc. Natl. Acad. Sci. USA 93: 357-361, 1996. PubMed: 8552638 Chambers RS, Sullivan PA. Expression of the exoglucanase gene in yeast and hyphal forms of Candida albicans. FEMS Microbiol. Lett. 111: 63-67, 1993. PubMed: 8359681 OSullivan JM, et al. Adhesion of Candida albicans to oral streptococci is promoted by selective adsorption of salivary proteins to the streptococcal cell surface. Microbiology 146: 41-48, 2000. PubMed: 10658650 Odds FC, Hierholzer JC. Purification and properties of a glycoprotein acid phosphatase from Candida albicans. J. Bacteriol. 114: 257-266, 1973. PubMed: 4633344 Goodwin TJ, Busby JN, Poulter RT. A yeast model for target-primed (non-LTR) retrotransposition. BMC Genomics 8: 263, 2007. PubMed: 17683538 Holmes AR, et al. Heterozygosity and functional allelic variation in the Candida albicans efflux pump genes CDR1 and CDR2. Mol Microbiol 62: 170-186, 2006. PubMed: 16942600 Goodwin TJD, et al. Ty3/gypsy-like retrotransposons in Candida albicans and Candida dubliniensis: Tca3 and Tcd3. Yeast 20: 493-508, 2003. PubMed: 12722183 Giblin L, et al. A DNA polymorphism specific to Candida albicans strains exceptionally successful as human pathogens. Gene 272: 157-164, 2001. PubMed: 11470521 Murad AM, et al. NRG1 represses yeast-hypha morphogenesis and hypha-specific gene expression in Candida albicans. EMBO J 20: 4742-4752, 2001. PubMed: 11532938 Wagner T, et al. pH-dependent denaturation of extracellular aspartic proteinases from Candida species. J. Med. Vet. Mycol. 33: 275-278, 1995. PubMed: 8531028 |