| 产品名称: | Scleromitrula shiraiana (Hennings) Imai |
|---|---|
| 商品货号: | TS176379 |
| Strain Designations: | TMI 65012 |
| Application: | characterization |
| Biosafety Level: | 1
Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country. |
| Product Format: | frozen |
| Type Strain: | no |
| Preceptrol®: | no |
| Comments: | characterization |
| Morphology: | After 2 weeks colonies are olive grey on surface and dark olive brown on reverse. Later, pustules containing milk colored, microconidial mass are produced in concentric zones. Microconidia are ellipsoid to obovoid, one celled and measure 4.8~3.2 × 2.7~2.1 µm. Sclerotia are black, hard and variable in size and shape.xa0 Apothecia are produced one to several per sclerotium. The heads are ochraceous to umber, ovoid to ellipsoid and measure. Stipes are brown, straight, slender, cylindrical, 27-108 mm long and 0.4-0.8 mm wide. |
| Medium: | ATCC® Medium 336: Potato dextrose agar (PDA) |
| Growth Conditions: | Temperature: 24.0°C |
| Sequenced Data: | 18S ribosomal RNA gene, partial sequence; internalxa0xa0 transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence.
AGCGCTTCCCTTTCAACAATTTCACGTACTGTTTAACTCTCTTTCCAAAGTGCTTTTCATCTTTCGATCACTCTACTTGTGCGCTATCGGTCTCTGGCCAATATTTAGCTTTAGATGAAATATCCACCCATTTTGAGCTGCATTCCCAAACAACTCGACTCGTCGAAAGAGTTTCACATAGGCATAGGTATCCAGTCACATACGGGATTCTCACCCTCTATGACGTCCTGTTCCAAGGAACTTAGACCGGACCACACCCGAAACATCTTCTACAAATTACAACTCGGAGTCTGAAAGACCCAGATTTCAAATTTGAGCTTATGCCGCTTCACTCGCCGTTACTGAGGCAATCCCTGTTGGTTTCTTTTCCTCCGCTTTTGATATGCTTAAGTTCAGCGGGTATCCCTACCTGATCCGAGGTCAACCATAGAAAATTGGGTGTTTAATGGCAGAGGCACGCGGGGAACCTGTAGCGAGAAAGAAATTACTACGCTCAGGACCCAAGTCACCGCACACTGATTTTAAGGCCCGCCATTTTATTGGCAAAGCCCAATACCAAGCAGAGCTTGAGGGTTGAAATGACGCTCGAACAGGCATGCCCCCCGGAATACCAAGGGGCGCAATGTGCGTTAAAGATTCGATGATTCACTGAATTCTGCAATTCACATTACTTATCGCATTTCGCTGCGTTCTTCATCGATGCCAGAACCAAGAGATCCGTTGTTGAAAGTTTTAACTATTATATAGTACTCAGACAAACTAATAAACAGAGTTTAAATATTCTTCGGCGGGCGAGCAAGCCCTAAAGCACCCGCAGGCGCAACCCACCAAAGCAACATAGTATAAATACACAAGGGTGGGAGGTCTACCCATTAGGGCATGAA |
| Name of Depositor: | LM Kohn |
| Chain of Custody: | ATCC < |
| Isolation: | Mulberry, Morus alba, Japan |
| References: | Kohn LM, Nagasawa E. The genus Scleromitrula (Sclerotiniaceae), Episclerotium gen. nov. (Leotiaceae) and allied stipitate-capitate species with reduced ectal excipula. Trans. Mycol. Soc. Jpn. 25: 127-148, 1984. |