微信小陈
微信小章| 产品名称： | Saccharomyces cerevisiae Meyen ex E.C. Hansen |
|---|---|
| 商品货号： | TS176751 |
| Deposited As： | Saccharomyces cerevisiae Hansen, teleomorph |
| Classification： | Saccharomycetes, Saccharomycetidae, Saccharomycetales, Saccharomycetaceae, Saccharomycetaceae, Saccharomyces, cerevisiae |
| Strain Designations： | EGY48 |
| Alternate State： | Candida robusta Diddens et Lodder |
| Application： | transformation host for plasmids expressing LexA fusions, AD fusions, and lexA operator-lacZ reporters transformation host for two-hybrid screening |
| Biosafety Level： | 1
Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country. |
| Product Format： | frozen |
| Type Strain： | no |
| Genotype： | MATalpha ura3 his3 trp1 LexA((op(x6)-LEU2
Ref  Rosamond J. Two-hybrid analysis of protein-protein interactions in yeast. Methods Microbiol. 26: 255-268, 1998. |
| Preceptrol®： | no |
| Mating Type： | alpha |
| Ploidy： | haploid |
| Comments： | This material is available under the condition that it will not be used for commercial purpose or distributed to third parties. |
| Morphology： | After 3 days at 25°C growth is butyrous and light cream colored.xa0 Cells are globose, ovoidal or elongate, (3.0-8.0) x (5.0-10.0) µm, and are isolated or in small groups.xa0 Sediment is present after one month.xa0 |
| Medium： | ATCC® Medium 1245: YEPD |
| Growth Conditions： | Temperature: 25°C
Atmosphere: Typical aerobic |
| Sequenced Data： | 18S ribosomal RNA gene, partial sequence; internalxa0xa0 transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence.
xa0xa0 GATTTGAGGTCAACTTTAAGAACATTGTTCGCCTAGACGCTCTCTTCTTATCGATAACGTTCCAATACGCTCAGTATAAAAAAAGATTAGCCGCAGTTGGTAAAACCTAAAACGACCGTACTTCATTATACCTCAAGCACGCAGAGAAACCTCTCTTTGGAAAAAAAACATCCAATGAAAAGGCCAGCAATTTCAAGTTAACTCCAAAGAGTATCACTCACTACCAAACAGAATGTTTGAGAAGGAAATGCGCTCAAACAGGCATGCCCCCTGGAATACCAAGGGGCGCAATGTGCGTTCAAAGATTCGATGATTCACGGAATTCTGCAATTCACATTACGTATCGCATTTCGCTGCGTTCTTCATCGATGCGAGAACAAGAGATCCGTTGTTGAAAGTTTTTAATATTTTAAAATTTCCAGTTACGAAAATTCTTGTTTTTGACAAAAATTTAATGAATAGATAAAATTGTTTGTGTTTGTTACCTCTGGGCCCCGATTGCTCAATGCCCAAAGAAAAAGTTGCAAAGATATGAAAACTCCACAGTGTGTTGTATTGAAACGGTTTTAATTGTCCTATAACAAAAGCACAGAAATCTCTCACCGTTTGGAATAGCAAGAAAGAAACTTACAGCCTAGCAAGACCGCGCACTTAAGCGCAGGCCCGGCTGGACTCTCCATCTCTTGTCTTCTTGCCCAGTAAAAGCTCTCATGCTCTTGCCAAAACAAAAAAATCCATTTTCAAAAT |
| Name of Depositor： | EA Golemis |
| Special Collection： | NCRR Contract |
| Isolation： | derived from a cross of EGY38 x GG100-14D |
| References： | Serebriiskii I, et al. Approaches to detecting false positives in yeast two-hybrid systems. BioTechniques 28: 328-336, 2000. PubMed: 10683744 Estojak J, et al. Correlation of two-hybrid affinity data with in vitro measurements. Mol. Cell. Biol. 15: 5820-5829, 1995. PubMed: 7565735 Gyuris J, et al. Cdi1, a human G1 and S phase protein phosphatase that associates with Cdk2. Cell 75: 791-803, 1993. PubMed: 8242750 Rosamond J. Two-hybrid analysis of protein-protein interactions in yeast. Methods Microbiol. 26: 255-268, 1998. Rosamond J. Two-hybrid analysis of protein-protein interactions in yeast. Methods Microbiol. 26: 255-268, 1998. |