| 产品名称: | Geosmithia morbida |
|---|---|
| 商品货号: | TS178784 |
| Classification: | Ascomycota, Hypocreales, Bionectriaceae |
| Strain Designations: | GM-30-47TDFJH001 |
| Biosafety Level: | 1
Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country. |
| Product Format: | frozen |
| Storage Conditions: | Frozen: -80°C or colder Freeze-Dried: 2°C to 8°C Live Culture: See Propagation Section |
| Type Strain: | no |
| Genotype: | Not available |
| Preceptrol®: | no |
| Comments: | Plant pathogen |
| Morphology: | On PDA medium at 25°C after 16 days, colonies brown with tan margin, covered in moderately dense layer of white cottony mycelium, deeply lobbed margin, turns media bright yellow. Reverse dark reddish brown with tan margin. Hyphae guttulate. Conidiophores branched, verrucose, biverticillate to triverticillate. Conidia ovoid, smooth, 7.5-10.5 x 3.75-4.5 µm. |
| Medium: | ATCC® Medium 200: YM agar or YM broth ATCC® Medium 324: Malt extract agar ATCC® Medium 336: Potato dextrose agar (PDA) |
| Growth Conditions: | Temperature: 20°C to 25°C Atmospheric: Typical aerobic |
| Sequenced Data: |
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence; GenBank number KC113640:
AGGGATCATTATCGAGTTACCAACTCCAAACCTTTGTGAACCTTACCACAGTTGCTTCGGCGGCCCCGCCCCGGGCGCCTCGGGATCCCCCCCCTAGGGGGCCCCGCGGGCGACCCGGACCCAGGCGACCGCCGGGGGACCCAAACTCTTGTCTTTTAGTGTATTATCTGAGTGGCATAAGCAAATAAATTAAAACTTTCAGCAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGTACTCTGGCGGGCATGCCTGTCCGAGCGTCATTTCAACCCTCAGCACCCCCGTTCGCGGCGGGAGCTGGCGTTGGGGATCGGCCGTCCTCTGCGGCGGCCGGCCCCGAAACGAAGTGGCGGTCACGTCGCGACCTCCTCTGCGTAGTAGCAATATCTCGCAGCCTGGATAGCGGCGCGGCCACGCCGTAAAACCCCAACTATACCAAGGTTGACCTCGGATCAGGTAGGAATACCCGCTGAACTTAA |
| Name of Depositor: | D. Hadziabdic |
| Chain of Custody: | ATCC <-- D. Hadziabdic; University of Tennessee <-- L. Vito; Culture Maintance <-- M. Windham; Collector |
| Isolation: | Juglans nigra, Knox County, TN, USA. |
| Cross References: | Nucleotide (GenBank) : KC113640 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence |
| References: | Hadziabdic D, et al. Development and characterization of sixteen microsatellite loci for Geosmithia morbida, the causal agent of thousand canker disease in black walnut (Juglans nigra). Conservation Genet. Res. 4(2): 287-289, 2012. |