| 产品名称: | Schizosaccharomyces pombe Lindner |
|---|---|
| 商品货号: | TS179511 |
| Strain Designations: | 972 h- |
| Application: | Produces 1,3-beta-glucan synthase Produces citrulline |
| Biosafety Level: | 1
Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country. |
| Product Format: | freeze-dried |
| Storage Conditions: | Frozen: -80°C or colder Freeze-Dried: 2°C to 8°C Live Culture: See Propagation Section |
| Type Strain: | no |
| Preceptrol®: | no |
| Genome Sequenced Strain: | Yes |
| Comments: | Wild type, resists inositol starvation
Nucleotide sequence of SSP1 gene
Genome sequencing strain (S. pombe European Sequencing Consortium (EUPOM); Broad Institute, USA) |
| Medium: | ATCC® Medium 28: Emmons modification of Sabourauds agar ATCC® Medium 200: YM agar or YM broth ATCC® Medium 1245: YEPD |
| Growth Conditions: | Temperature: 30°C Atmosphere: Typical aerobic |
| Sequenced Data: |
D1D2 region of the 26S ribosomal RNA gene ATATCAATAAGCGCAGGAAAAGAAAATAACCATGATTCCCTCAGTAACGGCGAGTGAAGCGGGAAAAGCTCAAATTTGAAATCTGGCAACATTTCTTTTGTTGTCCGAGTTGTAATTTCAAGAAGCTGCTTTGAGTGTAGACGATCGGTCTAAGTTCCTTGGAACAGGACGTCAGAGAGGGTGAGAACCCCGTCTTTGGTCGATTGGATATGCCATATAAAGCGCTTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTAGAGTGATCGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAATAGTACGTGAAATTGCTGAAAGGGAAGCATTGGAAATCAGTCTTACCTGGGTGAGATCAGTAGTCTCTTCGCGAGACTATGCACTCTGAACCTGTGGTAGGTCAGCATCAGTTTTCGGGGGCGGAAAAAGAATAAGGGAAGGTGGCTTTCCGGGTTCTGCCTGGGGAGTGTTTATAGCCCTTGTTGTAATACGTCCACTGGGGACTGAGGACTGCGGCTTCGTGCCAAGGATGCTGACATAATGGTTTTCAATGGC |
| Name of Depositor: | A Ali |
| Chain of Custody: | ATCC |
| Cross References: | Nucleotide (GenBank) : CU329670 Schizosaccharomyces pombe chromosome I. |
| References: | Varona R, et al. Effect of papulacandin B on beta-glucan synthesis in Schizosaccharomyces pombe. FEMS Microbiol. Lett. 20: 243-247, 1983. . . Genetika 2: 161, 1970. Kasai H, Isono K. Dual modes of transcriptional and translational initiation of SSP1, the gene for a mitochondrial HSP70, responding to heat-shock in Schizosaccharomyces pombe. Nucleic Acids Res. 19: 5331-5337, 1991. PubMed: 1923816 Ali AM. Genetical control of citrulline accumulation in Neurospora crassa and Schizosaccharomyces pombe. Egypt. J. Genet. Cytol. 1: 120-121, 1972. Wood V, et al. The genome sequence of Schizosaccharomyces pombe. Nature 415: 871-880, 2002. Wang H, et al. A fungal phylogeny based on 82 complete genomes using the composition vector method. BMC Evol. Biol. 9: 195, 2009. PubMed: 19664262 Sasaki M, et al. The gap-filling sequence on the left arm of chromosome 2 in fission yeast Schizosaccharomyces pombe. Yeast 25: 673-679, 2008. PubMed: 18727152 Proshkina GM, et al. Ancient origin, functional conservation and fast evolution of DNA-dependent RNA polymerase III. Nucleic Acids Res 34: 3615-3624, 2006. PubMed: 16877568 Hayashi K, et al. Studies of Schizosaccharomyces pombe TFIIE indicate conformational and functional changes in RNA polymerase II at transcription initiation. Genes Cells 10: 207-224, 2005. PubMed: 15743411 Hamasaki-Katagiri N, et al. Fission yeast homolog of neuronal calcium sensor-1 (Ncs1p) regulates sporulation and confers calcium tolerance. J Biol Chem 279: 12744-12754, 2004. PubMed: 14722091 Bamps S, et al. Mcs2 and a novel CAK subunit Pmh1 associate with Skp1 in fission yeast. Biochem Biophys Res Commun 325: 1424-1432, 2004. PubMed: 15555586 Lee J, et al. Regulation and the role of Cu,Zn-containing superoxide dismutase in cell cycle progression of Schizosaccharomyces pombe. Biochem Biophys Res Commun 297: 854-862, 2002. PubMed: 12359231 Hirata D, et al. Fission yeast Mor2/Cps12, a protein similar to Drosophila Furry, is essential for cell morphogenesis and its mutation induces Wee1-dependent G(2) delay. EMBO J 21: 4863-4874, 2002. PubMed: 12234926 Machida M, et al. A 38 kb segment containing the cdc2 gene from the left arm of fission yeast chromosome II: sequence analysis and characterization of the genomic DNA and cDNAs encoded on the segment. Yeast 16: 71-80, 2000. PubMed: 10620777 Jimenez M, et al. The alm1+ gene from Schizosaccharomyces pombe encodes a coiled-coil protein that associates with the medial region during mitosis. Mol Gen Genet 262: 921-930, 2000. PubMed: 10660053 Bonnefoy N, et al. The respiratory gene OXA1 has two fission yeast orthologues which together encode a function essential for cellular viability. Mol Microbiol 35: 1135-1145, 2000. PubMed: 10712694 Crane R, et al. A fission yeast homolog of Int-6, the mammalian oncoprotein and eIF3 subunit, induces drug resistance when overexpressed. Mol Biol Cell 11: 3993-4003, 2000. PubMed: 11071922 Hardeland U, et al. Separating substrate recognition from base hydrolysis in human thymine DNA glycosylase by mutational analysis. J Biol Chem 275: 33449-33456, 2000. PubMed: 10938281 Franco A, et al. Characterization of tpp1(+) as encoding a main trehalose-6P phosphatase in the fission yeast Schizosaccharomyces pombe. J Bacteriol 182: 5880-5884, 2000. PubMed: 11004189 Heiland S, et al. Multiple hexose transporters of Schizosaccharomyces pombe. J. Bacteriol. 182: 2153-2162, 2000. PubMed: 10735857 |