| 产品名称: | Quantitative Synthetic Dengue virus type 3 RNA |
|---|---|
| 商品货号: | TS180319 |
| Agent: | Quantitative Synthetic Dengue virus type 3 RNA |
| Applications: | ATCC® Genuine Nucleics can be used for assay development, verification, validation, monitoring of day to day test variation, and lot to lot performance of molecular-based assays. The quantitative format allows for the generation of a standard curve for quantitative PCR (qPCR) to determine viral load. |
| Biosafety Level: | 1
Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country. |
| Product Format: | frozen Specification range: 1 x 105 - 1 x 106 copies/µL 100 µL per vial with Biomatrica RNAstable |
| Storage Conditions: | -70°C or colder |
| Intended Use: | The synthetically engineered sequence of the product constitutes intellectual property belonging to ATCC. Unauthorized use, including sequencing, modification, or reverse-engineering, of the product is expressly prohibited without prior ATCC consent. |
| Comments: | Manufactured under ISO 13485 guidance Preparation includes fragments from the capsid, membrane, and envelope regions. The following primers and probe can be used with this nucleic acid preparation Ref ![]() Centers for Disease Control and Prevention (CDC). CDC DENV-1-4 Real-Time RT-PCR Assay for Detection and Serotype Identification of Dengue Virus. Instructions for Use Package Insert.:Forward primer: GGACTRGACACACGCACCCA Reverse primer: CATGTCTCTACCTTCTCGACTTGYCT Probe: ACCTGGATGTCGGCTGAAGGAGCTTG |
| Special Collection: | RNA |
| References: | Waggoner JJ, et al. Development of an internally controlled real-time reverse transcriptase PCR assay for pan-dengue virus detection and comparison of four molecular dengue virus detection assays. J. Clin. Microbiol. 51(7): 2172-2181, 2013. PubMed: 23637298 Waggoner JJ, et al. Single-reaction, multiplex, real-time rt-PCR for the detection, quantitation, and serotyping of dengue viruses. PLoS Negl. Trop. Dis. 7(4): e2116, 2013. PubMed: 23638191 Centers for Disease Control and Prevention (CDC). CDC DENV-1-4 Real-Time RT-PCR Assay for Detection and Serotype Identification of Dengue Virus. Instructions for Use Package Insert. |

Centers for Disease Control and Prevention (CDC). CDC DENV-1-4 Real-Time RT-PCR Assay for Detection and Serotype Identification of Dengue Virus. Instructions for Use Package Insert.