| 产品名称: | Candida sorbophila (Nakase) Meyer et Yarrow, anamorph |
|---|---|
| 商品货号: | TS184682 |
| Strain Designations: | MY1833 |
| Application: | produces N-(R)-(2-hydroxy-2-pyridine-3-yl-ethyl)-2-(4-nitro-phenyl)-acetamide |
| Biosafety Level: | 1
Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country. |
| Product Format: | frozen |
| Storage Conditions: | Frozen: -80°C or colder Freeze-Dried: 2°C to 8°C Live Culture: See Propagation Section |
| Type Strain: | no |
| Disclosure: | This material is cited in a US or other Patent and may not be used to infringe the claims. Depending on the wishes of the Depositor, ATCC may be required to inform the Patent Depositor of the party to which the material was furnished. This material may not have been produced or characterized by ATCC. |
| Preceptrol®: | no |
| Medium: | ATCC® Medium 1245: YEPD ATCC® Medium 28: Emmons modification of Sabourauds agar ATCC® Medium 200: YM agar or YM broth |
| Growth Conditions: | Temperature: 24° to 26°C
Atmosphere: Typical aerobic |
| Sequenced Data: |
D1D2 region of the 26S ribosomal RNA gene CATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTTAGTAGCGGCGAGTGAAGCGGCAATAGCTCAAATTTGAAATCTGCCAACAGGCCGAGTTGTAATTTGAAGAAAGCAATTCTGGATGTGTCTTTGCTCAAGTTCCTTGGAAYAGGACATCATGGAGGGTGAGAATCCCGTGATGCGAAGGTAGCAYRTCTATGTAGAATGTTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAGTGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACTGTGAAGGAAAGATGAAAAGAACTTTGAAAAGAGAGTGAAAAAGTACGTGAAATTGTTGAAATGGAAGGGCTTGAGATTAGACATGGTGTTTAGTGTTCCRCTTTCTTTYGGGAATGTGTACTCGCTTTACACCGGGCCAGCATCAGTTTTGATGGGAGGATAAAWGGTATTGAATGTGGCTGCTTGCAGTGTTATAGCTTTATCAAATACTTCCAATCGGGACTGAGGACCGCGCATTTGCTAGGATGCTGGCGTAATGATCTTAAGCCA |
| Name of Depositor: | Merck & Co., Inc. |
| U.S. Patent Number: | |
| Special Collection: | NCRR Contract |
| References: | Chartrain MM, et al. N-(R)-(2-hydroxy-2-pyridine-3-yl-ethyl)-2-(4-nitro-phenyl)-acetamide. US Patent 5,846,791 dated Dec 8 1998 |