微信小陈
微信小章| 产品名称： | Trichoderma atroviride Karsten sensu Bissett |
|---|---|
| 商品货号： | TS185159 |
| Deposited As： | Trichoderma lignorum (Tode) Harz, anamorph |
| Strain Designations： | 2440A CBS 391.92 |
| Alternate State： | Hypocrea atroviridis Dodd et al. |
| Application： | produces peptaibol antibiotics |
| Biosafety Level： | 1
Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country. |
| Product Format： | freeze-dried |
| Type Strain： | no |
| Preceptrol®： | no |
| Comments： | postharvest decay of citrus fruit |
| Morphology： | After 12 days on Blakeslee’s malt extract medium at 25°C, colony is low to floccose, mycelium white to yellow, conidial areas green, reverse uncolored. Chlamydospores globose, hyaline, intercalary or terminal on short branches. Conidiophores hyaline, with pyramidal branching, phialides in terminal verticils. Conidia subglobose, smooth-walled, green. |
| Medium： | ATCC® Medium 325: Malt extract agar (Blakeslees formula) ATCC® Medium 336: Potato dextrose agar (PDA) |
| Growth Conditions： | Temperature: 24°C |
| Sequenced Data： |
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence.
GGATCATTACCGAGTTTACAACTCCCAAACCCAATGTGAACCATACCAAACTGTTGCCTCGGCGGGGTCACGCCCCGGGTGCGTCGCAGCCCCGGAACCAGGCGCCCGCCGGAGGGACCAACCAAACTCTTTTCTGTAGTCCCCTCGCGGACGTTATTTCTTACAGCTCTGAGCAAAAATTCAAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGTATTCTGGCGGGCATGCCTGTCCGAGCGTCATTTCAACCCTCGAACCCCTCCGGGGGGTCGGCGTTGGGGACCTCGGGAGCCCCTAAGACGGGATCCCGGCCCCGAAATACAGTGGCGGTCTCGCCGCAGCCTCTCCTGCGCAGTAGTTTGCACAACTCGCACCGGGAGCGCGGCGCGTCCACGTCCGTAAAACACCCAACTTCTGAAATGTTGACCTCGGATCAGGTAGGAATACCCGCTGAAC |
| Name of Depositor： | D Knosel |
| Isolation： | lemon |
| Cross References： | Nucleotide (GenBank) : AF049075 Trichoderma harzianum internal transcribed spacer 1, partial Nucleotide (GenBank) : U05192 Trichoderma harzianum orotidine-5-phosphate decarboxylase (pyr4) Nucleotide (GenBank) : AF276093 Trichoderma atroviride strain TS185159 small subunit ribosomal Nucleotide (GenBank) : AF278796 Trichoderma atroviride strain TS185159 18S ribosomal RNA gene, Nucleotide (GenBank) : AF276651 Trichoderma atroviride strain TS185159 endochitinase 42 (ech42) Nucleotide (GenBank) : Z48812 internal transcribed spacers, ITS-1 and ITS-2, and the 5.8S ribosomal DNA, sequences |
| References： | . . Phytopathol. Z. 85: 217-226, 1976. Schirmbock M, et al. Parallel formation and synergism of hydrolytic enzymes and peptaibol antibiotics, molecular mechanisms involved in the antagonistic action of Trichoderma harzianum against phytopathogenic fungi. Appl. Environ. Microbiol. 60: 4364-4370, 1994. PubMed: 7811076 Ospina-Giraldo MD, et al. Phylogenetic relationships of Trichoderma harzianum causing mushroom green mold in Europe and North America to other species of Trichoderma from world-wide sources. Mycologia 90: 76-81, 1998. |