微信小陈
微信小章| 产品名称： | Penicillium brevicompactum Dierckx |
|---|---|
| 商品货号： | TS187692 |
| Deposited As： | Penicillium brevi-compactum Dierckx |
| Strain Designations： | NRRL 864 42, 4733.21, ATCC 10418, CBS 257.29, DSM 3825, Dierckx, IMI 40225, MUCL 30241, NRRL 2011, QM 7496 |
| Application： | Produces asperphenamate
Produces brevianamide A
Produces brevianamide B
Produces ergosterol
Produces hydroxygrindelanes
Produces mycophenolic acid
Produces insecticide hydroxygrindelanes |
| Biosafety Level： | 1
Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country. |
| Product Format： | freeze-dried |
| Storage Conditions： | Frozen: -80°C or colder Freeze-Dried: 2°C to 8°C Live Culture: See Propagation Section |
| Type Strain： | yes |
| Preceptrol®： | no |
| Comments： | Transformations of antitumor agents Life cycle |
| Morphology： | Colonies on malt agar growing moderately rapidly, granular, olivaceous-green, reverse yellowish to reddish-brown. Conidiophore stipes smooth-walled; penicillia generally terverticillate. Phialides flask-shaped. Conidia smooth-walled or slightly verruculose, ellipsoidal, 2.5-3.5 µm. |
| Medium： | ATCC® Medium 312: Czapeks agar ATCC® Medium 323: Malt agar medium ATCC® Medium 336: Potato dextrose agar (PDA) |
| Growth Conditions： | Temperature: 24°C to 26°C Atmosphere: Typical aerobic |
| Sequenced Data： |
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence CTGCGGAAGGATCATTACCGAGTGAGGGCCCTCTGGGTCCAACCTCCCACCCGTGTTTATTTTACCTTGTTGCTTCGGCGAGCCTGCCTTTTGGCTGCCGGGGGACGTCTGTCCCCGGGTCCGCGCTCGCCGAAGACACCTTAGAACTCTGTCTGAAGATTGTAGTCTGAGATTAAATATAAATTATTTAAAACTTTCAACAACGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCTCTGGTATTCCGGAGGGCATGCCTGTCCGAGCGTCATTGCTGCCCTCAAGCACGGCTTGTGTGTTGGGCTCCGTCCTCCTTCCGGGGGACGGGCCCGAAAGGCAGCGGCGGCACCGCGTCCGGTCCTCAAGCGTATGGGGCTTTGTCACCCGCTTTGTAGGACTGGCCGGCGCCTGCCGATCAACCAAACTTTTTTCCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAA |
| Name of Depositor： | NRRL |
| Chain of Custody： | ATCC <-- NRRL <-- C. Thom 4733.21 <-- P. Biourge 42, strain Dierckx |
| Cross References： | Nucleotide (GenBank) : JQ070074 ITS including 5.8S rRNA gene |
| References： | Bird BA, Campbell IM. Disposition of mycophenolic acid, brevianamide A, asperphenamate, and ergosterol in solid cultures of Penicillium brevicompactum. Appl. Environ. Microbiol. 43: 345-348, 1982. Bartman CD. Mycophenolic acid production by Penicillium brevicompactum on solid media. Appl. Environ. Microbiol. 41: 729-736, 1981. . The genus Penicillium. London: Academic Press; 1979. Doerfler DL, et al. Spore germination, colony development, and secondary metabolism in Penicillium brevicompactum: a radiogas chromatographic and morphological study. Can. J. Microbiol. 24: 1490-1501, 1978. PubMed: 747811 Chien MM, Rosazza JP. Microbial transformations of natural antitumor agents. 9. O-Demethylation of 9-methoxyellipticine. J. Nat. Prod. 42: 643-647, 1979. PubMed: 575547 Bird BA, Campbell IM. Occurrence and biosynthesis of asperphenamate in solid cultures of Penicillium brevicompactum. Phytochemistry 21: 2405-2406, 1982. Hoffmann JJ, et al. Hydroxygrindelane derivatives by microbial transformation. Phytochemistry 27: 2125-2127, 1988. Bird BA, et al. Brevianamides A and B are formed only after conidiation has begun in solid cultures of Penicillium brevicom pactum. Appl. Environ. Microbiol. 42: 521-525, 1981. Clutterbuck PW, Raistrick H. Studies in the biochemistry of microorganisms. The molecular constitution of the metabolic products of Penicillium brevi-compactum Dierckx and related species. II. Mycophenolic acid. Biochem. J. 27: 654-667, 1933. Houbraken J, Samson RA. Phylogeny of Penicillium and the segregation of Trichocomaceae into three Families. Stud Mycol 70: 1-51, 2011. PubMed: 22308045 Peterson SW, Horn BW. Penicillium parvulum and Penicillium georgiense, sp. nov., isolated from the conidial heads of Aspergillus species. Mycologia 101: 71-83, 2009. PubMed: 19274850 An KD, et al. The identity of Penicillium sp. 1, a major contaminant of the stone chambers in the Takamatsuzuka and Kitora Tumuli in Japan, is Penicillium pineum. Antonie van Leeuwenhoek 96: 579-592, 2009. PubMed: 19784794 Scott JA, et al. A survey of Penicillium brevicompactum and P. bialowiezense from indoor environments with commentary on the taxonomy of the P. brevicompactum group. Can J Bot 86: 732-741, 2008. Wang L, Zhang XM, Zhuang WY. Penicillium macrosclerotiorum, a new species producing large sclerotia discovered in south China. Mycol Res 111: 1242-1248, 2007. PubMed: 17998158 Serra R, Peterson SW. Penicillium astrolabium and Penicillium neocrassum, two new species isolated from grapes and their phylogenetic placement in the P. olsonii and P. brevicompactum clade. Mycologia 99: 78-87, 2007. PubMed: 17663125 Peterson SW. Multilocus DNA sequence analysis shows that Penicillium biourgeianum is a distinct species closely related to P. brevicompactum and P. olsonii. Mycol Res 108: 434-440, 2004. PubMed: 15209283 |