微信小陈
微信小章| 产品名称： | Schizophyllum commune Fries |
|---|---|
| 商品货号： | TS189186 |
| Strain Designations： | Delmar 13 |
| Application： | produces acetyl-xylan esterase produces endo-1,4-beta-xylanase beta xylanase, endoxylanase produces endo-beta-1,4-glucanase produces endoglucanase produces esterase produces exo-beta-1,4-glucanase beta-(1,4)-glucanase, beta-1,4-glucanase produces ferulic acid esterase produces glucosidase, beta; acid Glucosidase, beta, acid, glucocerebrosidase produces polysaccharides produces scleroglucan produces sizofiran beta-1,3-/beta-1,6-glucan, schizophyllan produces xylan endo-1,3-beta-xylosidase xylan hydrolase, xylanase produces xylanase A produces: extracellular neutral polysaccharide high production of beta-glucosidase |
| Biosafety Level： | 1
Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country. |
| Product Format： | frozen |
| Storage Conditions： | Frozen: -80°C or colder Freeze-Dried: 2°C to 8°C Live Culture: See Propagation Section |
| Type Strain： | no |
| Preceptrol®： | no |
| Comments： | induction of cellulase with thiocellobiose tyrosyl residues in substrate binding sites |
| Morphology： | After two weeks at 25°C hyphae hyaline, nodose-septate clamp connections, chlamydospores present, rare, terminal and intercalary. |
| Medium： | ATCC® Medium 200: YM agar or YM broth ATCC® Medium 336: Potato dextrose agar (PDA) ATCC® Medium 479: Hagems-Modess medium |
| Growth Conditions： | Temperature: 25°C to 30°C Atmosphere: Typical aerobic |
| Sequenced Data： | 18S ribosomal RNA gene, partial sequence; internalxa0xa0 transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence.
AGTCAAAAGTTAGCGCACAAGTCGCTAGTCTCAGTCAAGAGACRGTTAGAAGCAGACTCCTATTGAAACTGACTAGGTCAGCCCCGAGATGGTCAACGACGTAGAAATTATCACATCGGAGACCGATCCCGCAAGGGAAATCCGCTAATGCATTTRAGAGGAGCTGGCTCCGTTAGGCTCCAGCA |
| Name of Depositor： | MG Paice |
| Chain of Custody： | ATCC |
| Isolation： | Elm twig |
| References： | Biely P, et al. Cooperativity of esterases and xylanases in the enzymatic degradation of acetyl xylan. Bio-Technology 4: 731-733, 1986. . . Bioprocess Eng. 6: 179-186, 1991. Bray MR, Clarke AJ. Action pattern of xylo-oligosaccharide hydrolysis by Schizophyllum commune xylanase A. Eur. J. Biochem. 204: 191-196, 1992. PubMed: 1740129 Bray MR, Clarke AJ. Essential carboxy groups in xylanase A. Biochem. J. 270: 91-96, 1990. PubMed: 2396996 Bray MR, Clarke AJ. Identification of an essential tyrosyl residue in the binding site of Schizophyllum commune xylanase A. Biochemistry 34: 2006-2014, 1995. PubMed: 7849058 Desrochers M, et al. High production of beta-glucosidase in Schizophyllum commune: Isolation of the enzyme and effect of the culture filtrate on cellulose hydrolysis. Appl. Environ. Microbiol. 41: 222-228, 1981. Desrochers M, et al. Production of cellulase, beta-glucosidase, and xylanase by Schizophyllum commune grown on a cellulose-peptone medium. Dev. Ind. Microbiol. 22: 675-684, 1981. Gura E, Rau U. Comparison of agitators for the production of branched þ-1,3-D-glucans by Schizophyllum commune. J. Biotechnol. 27: 193-201, 1993. Halgasova N, et al. Purification and some characteristics of the acetylxylan esterase from Schizophyllum commune. Biochem. J. 298: 751-755, 1994. PubMed: 8141793 MacKenzie CR, Bilous D. Ferulic acid esterase activity from Schizophyllum commune. Appl. Environ. Microbiol. 54: 1170-1173, 1988. Paice MG, et al. Production, characterization, and partial amino acid sequence of xylanase A from Schizophyllum commune. Appl. Environ. Microbiol. 36: 802-808, 1978. PubMed: 32833 Paice MG, et al. Two forms of endoglucanase from the basidiomycete Schizophyllum commune and their relationship to other beta-1, 4-glycoside hydrolases. Bio-Technology 2: 535-539, 1984. Prokop A, et al. Production of extracellular beta-1,3-/beta-1,6-Glucan by mono- and dikaryons of Schizophyllum commune. Exp. Mycol. 16: 197-206, 1992. Rau U, et al. Enhanced glucan formation of filamentous fungi by effective mixing, oxygen limitation and fed-batch processing. J. Ind. Microbiol. 9: 19-25, 1992. Rho D, et al. Induction of cellulose in Schizophyllum commune: thiocellobiose as a new inducer. J. Bacteriol. 149: 47-53, 1982. PubMed: 6798027 Willick GE, et al. Extracellular proteins secreted by the basidiomycete Schizophyllum commune in response to carbon source. J. Bacteriol. 159: 294-299, 1984. PubMed: 6429123 |