| 产品名称: | pLUS |
|---|---|
| 商品货号: | TS192080 |
| Designations: | pLUS |
| Depositors: | GG Hermanson |
| Biosafety Level: | 1 |
| Vector Information: | Size (kb): 9.5000000000000000 Vector: pLUS (plasmid) Promoters: Promoter T7 (phi10) Construction: pI-L13, pYAC4, pHSS6 Marker(s):kanR,LYS2 Construct size (kb): 9.5 Features: marker(s): kanR, LYS2 promoter: T7 (phi10) replicon: pMB1, ARS1 |
| Applications: | vector for other uses |
| Comments: | Restriction digests of the clone give the following sizes (kb): HindIII--9.5; BamHI--8.0, 1.4; EcoRI--7.7, 1.8; KpnI--5.6, 3.2, 0.6. Linearized vector is transformed into the YAC-containing yeast cells, followed by plating on medium lacking lysine and uracil (and containing 10 mg/L adenine to enhance the red color phenotype of recombinant clones). Positive colonies should have the rescue plasmid integrated into the artificial chromosome near the SalI site from pYAC4 (near URA3). Correctly integrated products will yield a 1855 bp amplification product. YAC end fragment clones can be isolated from properly integrated DNA by digestion with one of the enzymes in the polylinker, religation by circularization, and transformation into Escherichia coli. Permits isolation of end fragments up to 20 kb. The order of the major features in a recombinant YAC end fragment clone would be: T7 promoter - BamHI/polylinker/HindIII - URA end YAC insert - EcoRI - SalI/YAC4 - pMB1 ori - kanR. Vector designed to rescue the URA3 end of an insert from a yeast artificial chromosome (YAC) constructed in a pYAC4-derived vector. Based on homologous recombination with the pYAC vector. DNA from positive colonies can be screened for proper integration of the vector using the following primers: 5- CTTGAGATCGGGCGTTCGACTCGC -3 and 5- TGAACGGTGATCCCCACCGGAATTG -3, complementary to the YAC clone and the vector respectively. The order of the major features of the rescue vector is: T7 promoter - BamHI/polylinker/HindIII - LYS2 - EcoRI - SUP4 - SalI/YAC4 - URA3 - EcoRI - pMB1 ori - kanR. |
| Growth Conditions: | Temperature: 37.0°C |
| References: | Hermanson GG, et al. Rescue of end fragments of yeast artificial chromosomes by homologous recombination in yeast. Nucleic Acids Res. 19: 4943-4948, 1991. PubMed: 1923762 |
| Shipped: | freeze-dried |