微信小陈
微信小章| 产品名称： | Zygosaccharomyces rouxii (Boutroux) Yarrow |
|---|---|
| 商品货号： | TS194442 |
| Deposited As： | Saccharomyces bisporus var. mellis (Fabian et Quinet) van der Walt, teleomorph |
| Strain Designations： | pSB3, pSB4 IFO 1730, NCYC 1522, NCIMB 50106, DBVPG 6462, KCM0226, CBS 4357 |
| Alternate State： | Candida mogii Vidal-Leiria, Candida placentae Goto |
| Application： | Reference strain for performance testing culture media listed by the ISO TC 34 SC 9 Joint Working Group 5 in the ISO 11133 and by the Working Party on Culture Media of the International Committee on Food Microbiology and Hygiene (ICFMH-WPCM) Characterization of pSB3 and pSB4 Ref   Toh-e A, et al. Plasmids resembling 2-um DNA in the osmotolerant yeasts Saccharomyces bailii and Saccharomyces bisporus. J. Gen. Microbiol. 130: 2527-2534, 1984. PubMed: 6096485 |
| Biosafety Level： | 1
Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country. |
| Product Format： | freeze-dried |
| Storage Conditions： | Frozen: -80°C or colder Freeze-Dried: 2°C to 8°C Live Culture: See Propagation Section |
| Type Strain： | no |
| Preceptrol®： | no |
| Comments： | Carrying DNA plasmids pSB3 and pSB4
Contain an ARS sequence effective in Saccharomyces cerevisiae.
Sequenced plasmid genome pSB3 Ref Toh-e A, et al. Plasmids resembling 2-um DNA in the osmotolerant yeasts Saccharomyces bailii and Saccharomyces bisporus. J. Gen. Microbiol. 130: 2527-2534, 1984. PubMed: 6096485 |
| Morphology： | After 3 days at 25°C on YM agar, the cells are spherical to ovoid, 2-8 x 2-10 µm, and occur singly, in pairs or in small clusters. |
| Medium： | ATCC® Medium 28: Emmons modification of Sabourauds agar ATCC® Medium 200: YM agar or YM broth ATCC® Medium 1245: YEPD |
| Growth Conditions： | Temperature: 24°C to 26°C Atmosphere: Typical aerobic |
| Sequenced Data： |
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence:
GGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATAGAAAATGACGTGAACTCTTAACGGAGTTCTCTCAAAGTGTTGGAGGGGAAGGCCTGCGCTTAATTGCGCGGCTGTTTTTAATCTCCTCCGCCTTTGATACACACATTGGAGTTTCTACTTTTTTGTTCTCTTTGGGAGGGTTCTGCTCTCCCAGAGGTAAACACAAACAATCTTTTATTATACTATTAACACAGTCAAATGAATTTTAAAAACAAAATATTCAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAACTGCGATACGTAATGTGAATTGCAGAATTCCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGGGGGGCATGCCTGTTTGAGCGTCATTTCCCTCTCAAACTTTACGTTTGGTAGTGAGCGATACTCTACTCTGGAGTTTGCTTGAAAATGGGAGGCCATAGGCGAAGCATTGCTTTCCAATCCTGCGGCCCTCTGCTTACTTCCCCTTGTGGGTTGTGGCAGGGGAAAGCGGGAGGCGCCTTGCCACGATAGTCGTATTAGGTTTTACCGACTCGGCGAAAGTGAAGAGGTTTGCTTTTTAAAAAGAAGCAGGCAGCGTCTGGCTTGACAAAATTCTCAAAGTTTGACCTCAAATCAGGTAGGATTAC |
| Name of Depositor： | Institute for Fermentation (IFO) |
| Isolation： | salted beans |
| Cross References： | Nucleotide (GenBank) : JX174048 ITS including 5.8S rRNA gene |
| References： | Toh-e A, et al. Plasmids resembling 2-um DNA in the osmotolerant yeasts Saccharomyces bailii and Saccharomyces bisporus. J. Gen. Microbiol. 130: 2527-2534, 1984. PubMed: 6096485 . . 3rd Int. Mycol. Congress Abstracts : 31, 1983. |