| 产品名称: | Magnaporthe salvinii (Cattaneo) Krause et Webster |
|---|---|
| 商品货号: | TS200333 |
| Deposited As: | Helminthosporium sigmoideum var. irregulare Cralley et Tullis |
| Strain Designations: | LR 1675 |
| Biosafety Level: | 1
Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country. |
| Product Format: | frozen |
| Type Strain: | no |
| Preceptrol®: | no |
| Comments: | causes rice stem rot |
| Medium: | ATCC® Medium 343: V8 juice agar |
| Growth Conditions: | Temperature: 26.0°C |
| Sequenced Data: | xa0xa0xa0xa0xa0xa0 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence.
ATTGATATGCTTAAGTTCAGCGGGTATTCCTACCTGATCCGAGGTCAACCTAAGAAAAATTAGGGGGTTTAGCGGCTGGAGGCCCTCCGGGATGCCACCGAGCGAGGCGCGTTTTACCGCGAGTTACTGCGCTCAGGGCCCCAGCGGGTCCGCCGATGTACTTGGGGGCCCCGACCGCCGGGCGGCCGGGTGCCCCAACACCAAGCTGGGCTTGAGTGGTGAAATGACGCTCGAACAGGCATGCCCGCCGGAATACCGGCGGGCGCAATGTGCGTTCAAAGATTCGATGATTCACTGAATTCTGCAATTCACATTACTTATCGCATTTCGCTGCGTTCTTCATCGATGCCAGAACCAAGAGATCCGTTGTTGAAAGTTTTGATTATTTGTTTTTTTCCTCAGAGATACACCAAAAATTCAGAGTTTGTAACCTCCGGCGGCATCCTCCCCCGGGGGGGACTCGTCCGCCGAAGCAACAGTAAAGGTAAGGTTCACAGGGGTTGGAGTTTTTCAACTCTTTAATGATCCCTCCGCTGGTTCACCAACGGAGACCTTGTT |
| Name of Depositor: | MC Rush |
| Chain of Custody: | ATCC < |
| Isolation: | rice field soil, Louisiana |
| Cross References: | Nucleotide (GenBank) : FJ746639 ITS including 5.8S rRNA gene |
| References: | Rice diseases. Kew, Surrey, England: CMI; 1972. |