微信小陈
微信小章| 产品名称： | Candida viswanathii Sandhu et Randhawa |
|---|---|
| 商品货号： | TS201778 |
| Deposited As： | Candida tropicalis (Castellani) Berkhout, anamorph |
| Strain Designations： | SU-2 |
| Synonym： | Trichosporon lodderae Phaff et al., Fermentotrichon lodderae (Phaff et al.) Novák et Zsolt, Candida lodderae (Phaff et al.) Meyer et Ahearn, Candida aquaetextoris Vallini et al. |
| Application： | transformation host transformation host for site-specific modification of genome |
| Biosafety Level： | 1
Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country. |
| Product Format： | freeze-dried |
| Type Strain： | no |
| Disclosure： | This material is cited in a US or other Patent and may not be used to infringe the claims. Depending on the wishes of the Depositor, ATCC may be required to inform the Patent Depositor of the party to which the material was furnished. This material may not have been produced or characterized by ATCC. |
| Genotype： | ura3a/ura3b
Ref  Kanai T, et al. An n-alkane-responsive promoter element found in the gene encoding the peroxisomal protein of Candida tropicalis does not contain a C(6) zinc cluster DNA-binding motif. J Bacteriol 182: 2492-2497, 2000. PubMed: 10762250 |
| Preceptrol®： | no |
| Ploidy： | diploid |
| Morphology： | On YM agar at 25°C after 10 days, colonies creamy white to dingy white, butryous, smooth, slightly raised, margin filamentous. Cells subglobose to ovoid, smooth, guttulate, 9-12 X 5-7.5µm. Pseudohyphae present. |
| Medium： | ATCC® Medium 200: YM agar or YM broth ATCC® Medium 1245: YEPD |
| Growth Conditions： | Temperature: 20°C to 25°C
Atmosphere: Typical aerobic |
| Sequenced Data： |
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence; GenBank number :
TTAATTGCACCACATGTGTTTTTCACTGGACAGCTGCTTTGGCGGGGGGACTCGTTTCCGCCGCCAGAGGTCACAACTAAACCAAACTTTTTATTACCAGTCAACCATACGTTTTAATAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTATGAATTGCAGATATTCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTTGAGCGTCATTTCTCCCTCAAGCCCGCGGGTTTGGTGTTGAGCAATACGCCAGGTTTGTTTGAAAGACGTACGTGGAGACTATATTAGCGACTTAGGTTCTACCAAAACGCTTGTGCAGTCGGCCCACCACAGCTTTTCTAACTTTTGACCTCAAATCAGG xa0 D1D2 region of the 28S ribosomal RNA gene: ATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTTAGTAGCGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGCTCTTTCAGAGTCCGAGTTGTAATTTGAAGAAGGTATCTTTGGGCCTGGCTCTTGTCTATGTTTCTTGGAACAGAACGTCACAGAGGGTGAGAATCCCGTGCGATGAGATGACCCAGGTCCGTGTAAAGTTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACAGTGATGGAAAGATGAAAAGAACTTTGAAAAGAGAGTGAAAAAGTACGTGAAATTGTTGAAAGGGAAGGGCTTGAGATCAGACTTGGCATTTTGCATGTTGCTTCTTCGGGGGCGGCCTCTGCGGTTTGTCGGGCCAGCATCAGTTTGGGCGG |
| Name of Depositor： | Henkel Research Corp. |
| U.S. Patent Number： | |
| Special Collection： | NCRR Contract |
| Isolation： | Uracil-requiring auxotroph derived from ATCC 20336. |
| References： | Picataggio S, et al. Site-specific modification of the Candida tropicalis genome. US Patent 5,254,466 dated Oct 19 1993 Kanai T, et al. An n-alkane-responsive promoter element found in the gene encoding the peroxisomal protein of Candida tropicalis does not contain a C(6) zinc cluster DNA-binding motif. J Bacteriol 182: 2492-2497, 2000. PubMed: 10762250 Kanai T, et al. An n-alkane-responsive promoter element found in the gene encoding the peroxisomal protein of Candida tropicalis does not contain a C(6) zinc cluster DNA-binding motif. J Bacteriol 182: 2492-2497, 2000. PubMed: 10762250 |