| 产品名称: | Trichoderma reesei Simmons |
|---|---|
| 商品货号: | TS204320 |
| Strain Designations: | NRRL 11460 NRCC 2906, RUT-C30, VTT-D-86271 |
| Application: | Produces acetylesterase acetyl esterase Produces alkaline xylan endo-1,3-beta-xylosidase alkaline xylanase Produces alpha-L-arabinofuranosidase alpha-1,3-arabinosidase Produces alpha-galactosidase Produces alpha-glucuronidase Produces cellobiohydrolases I and II Produces endoglucanase Produces exo-cellobiohydrolase avicelase, endoglucanase I Produces lactase Produces mannan endo-1,4-beta-mannosidase beta-mannanase, mannanase Produces polygalacturonase endopolygalacturonase, pectinase Produces xylan endo-1,3-beta-xylosidase xylan hydrolase, xylanase Transformation host Produces beta-xylanases I and II Produces cellulase-poor xylanases Enhancement of cellulase production with citric acid Transformation host for expression of Phlebia radiata laccase gene |
| Biosafety Level: | 1
Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country. |
| Product Format: | freeze-dried |
| Storage Conditions: | Frozen: -80°C or colder Freeze-Dried: 2°C to 8°C Live Culture: See Propagation Section |
| Type Strain: | no |
| Preceptrol®: | no |
| Genome Sequenced Strain: | Yes |
| Comments: | Ethanol- and polyene-resistant Genome sequencing strain (the Joint Genome Institute at the Department of Energy, USA). |
| Morphology: | After 6 days on Potato Dextrose agar at 25°C, colony is low, velutinous, mycelium white, conidia blue-green en masse; reverse vibrant yellow. Conidia ovoid, green, smooth-walled. |
| Medium: | ATCC® Medium 336: Potato dextrose agar (PDA) ATCC® Medium 28: Emmons modification of Sabourauds agar ATCC® Medium 200: YM agar or YM broth |
| Growth Conditions: | Temperature: 24°C to 26°C Atmosphere: Typical aerobic |
| Sequenced Data: |
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence
GGTCTCCGTTGGTGAACCAGCGGAGGGATCATTACCGAGTTTACAACTCCCAAACCCCAATGTGAACGTTACCAATCTGTTGCCTCGGCGGGATTCTCTGCCCCGGGCGCGTCGCAGCCCCGGATCCCATGGCGCCCGCCGGAGGACCAACTCAAACTCTTTTTTCTCTCCGTCGCGGCTTCCGTCGCGGCTCTGTTTTACCTTTGCTCTGAGCCTTTCTCGGCGACCCTAGCGGGCGTCTCGAAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGTATTCTGGCGGGCATGCCTGTCCGAGCGTCATTTCAACCCTCGAACCCCTCCGGGGGGTCGGCGTTGGGGATCGGCCCCTCACCGGGCCGCCCCCGAAATACAGTGGCGGTCTCGCCGCAGCCTCTCCTGCGCAGTAGTTTGCACACTCGCACCGGGAGCGCGGCGCGGCCACAGCCGTAAAACACCCCAAACTCTGAAATGTTGACCTCGGATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAA D1D2 region of the 28S ribosomal RNA gene ATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCTTTCGGGTCCGAGTTGTAATTTGTAGAGGATGCTTTTGGCAAGGCGCCGCCCGAGTTCCCTGGAACGGGACGCCACAGAGGGTGAGAGCCCCGTCTGGCTGGCCGCCGAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTATATGTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACCTTGAAAAGAGGGTTAAATAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGTGACCAGACTTGGGCGCGGCGGATCATCCGGGGTTCTCCCCGGTGCACTTCGCCGTGTCCAGGCCAGCATCAGTTCGTCGCGGGGGAAAAAGGCTTCGGGAACGTGGCTCCCCTGGGAGTGTTATAGCCCGTTGCATAATACCCTGCGGTGGACTGAGGACCGCGCATCTGCAAGGATGCTGGCGTAATGGTCACCAGCGAC |
| Name of Depositor: | NRRL |
| Chain of Custody: | ATCC |
| Isolation: | Not available. |
| Cross References: | Nucleotide (GenBank) : KU729092 ITS including 5.8S rRNA gene Nucleotide (GenBank) : KU729195 D1/D2 region of 28S rRNA gene Nucleotide (GenBank) : X93938 T.reesei rRNA genes and ITS1 and ITS2 DNA (strain TS204320 |
| References: | Saddler JN, et al. Utilization of enzymatically hydrolyzed wood hemicelluloses by microorganisms for production of liquid fuels. Appl. Environ. Microbiol. 45: 153-160, 1983. Saloheimo M, et al. A lignin peroxidase-encoding cDNA from the white-rot fungus Phlebia radiata: characterization and expression in Trichoderma reesei. Gene 85: 343-351, 1989. PubMed: 2628172 Bailey MJ, et al. Effect of pH on production of xylanase by Trichoderma reesei on xylan- and cellulose-based media. Appl. Microbiol. Biotechnol. 40: 224-229, 1993. Kristufek D, et al. Coinduction of alpha-L-arabinofuranosidase and alpha-D-galactosidase formation in Trichoderma reesei RUT C-30. FEMS Microbiol. Lett. 115: 259-264, 1994. Haab D, et al. Protein hypersecretory Trichoderma reesei mutant RUT C-30 displays increased ethanol and polyene resistance. J. Biotechnol. 29: 97-108, 1993. Stralbrand H, et al. Purification and characterization of two beta-mannanases from Trichoderma reesei. J. Biotechnol. 29: 229-242, 1993. Sundberg M, Poutanen K. Purification and properties of two acetylxylan esterases of Trichoderma reesei. Biotechnol. Appl. Biochem. 13: 1-11, 1991. Saloheimo M, Niku-Paavola ML. Heterologous production of a ligninolytic enzyme: expression of the Phlebia radiata laccase gene in Trichoderma reesei. Bio-Technology 9: 987-990, 1991. Nyyssonen E, et al. Efficient production of antibody fragments by the filamentous fungus Trichoderma reesei. Bio-Technology 11: 591-595, 1993. PubMed: 7763606 Kurzatkowski W, et al. Ultrastructural localization of cellular compartments involved in secretion of the low molecular weight, alkaline xylanase by Trichoderma reesei. Arch. Microbiol. 159: 417-422, 1993. Poutanen K, et al. Deacetylation of xylans by acetyl esterases of Trichoderma reesei. Appl. Microbiol. Biotechnol. 33: 506-510, 1990. Gamerith G, et al. Cellulase-poor xylanases produced by Trichoderma reesei RUT C-30 on hemicellulose substrates. Appl. Microbiol. Biotechnol. 38: 315-322, 1992. Ehsani N, et al. Separation of enzymes produced by Trichoderma reesei with hydrophobic ultrafiltration membranes. Process Biochem. 31: 253-263, 1996. Siika-Aho M, et al. An alpha-glucuronidase from Trichoderma reesei RUT C-30. Enzyme Microb. Technol. 16: 813-819, 1994. Zeilinger S, et al. Conditions of formation, purification, and characterization of an alpha-galactosidase of Trichoderma reesei RUT C-30. Appl. Environ. Microbiol. 59: 1347-1353, 1993. PubMed: 8390816 Kadam KL, Keutzer WJ. Enhancement in cellulase production by Trichoderma reesei Rut-C30 due to citric acid. Biotechnol. Lett. 17: 1111-1114, 1995. Watson TG, Nelligan I. Pilot scale production of cellulase by Trichoderma reesei (RUT C-30). Biotechnol. Lett. 5: 25-28, 1983. Robison PD. Cellulase and xylanase production by Trichoderma reesei Rut C-30. Biotechnol. Lett. 6: 119-122, 1984. Castillo FJ, et al. Lactase production in continuous culture by Trichoderma reesei Rut-C30. Biotechnol. Lett. 6: 593-596, 1984. Kyriacou A, et al. Detection and characterization of the specific and nonspecific endoglucanases of Trichoderma reesei: evidence demonstrating endoglucanase activity by cellobiohydrolase II. Enzyme Microb. Technol. 9: 25-32, 1987. Zhang L, et al. A novel host-vector system for heterologous protein co-expression and purification in the Trichoderma reesei industrial strain RUT-C30. Biotechnol. Lett. 38: 89-96, 2016. PubMed: 26343029 Sun A, et al. Expression of the mammalian peptide hormone obestatin in Trichoderma reesei. N. Biotechnol. 33: 99-106, 2016. PubMed: 26341165 Reilly MC, et al. Deletion of homologs of the SREBP pathway results in hyper-production of cellulases in Neurospora crassa and Trichoderma reesei. Biotechnol. Biofuels 8: 121, 2015. PubMed: 26288653 Chuang YC, et al. Trichoderma reesei meiosis generates segmentally aneuploid progeny with higher xylanase-producing capability. Biotechnol. Biofuels 8: 30, 2015. PubMed: 25729429 Smith W, et al. Comparison of intracellular and secretion-based strategies for production of human α-galactosidase A in the filamentous fungus Trichoderma reesei. BMC Biotechnol. 14: 91, 2014. PubMed: 25344685 Okeke BC. Cellulolytic and xylanolytic potential of high β-glucosidase-producing Trichoderma from decaying biomass. Appl. Biochem. Biotechnol. 174: 1581-1598, 2014. PubMed: 25129039 Valkonen M, Penttilä M, Benčina M. Intracellular pH responses in the industrially important fungus Trichoderma reesei. Fungal Genet. Biol. 70: 86-93, 2014. PubMed: 25046860 Jovanović B, Mach RL, Mach-Aigner AR. Erythritol production on wheat straw using Trichoderma reesei. AMB Express 4: 34, 2014. PubMed: 24949268 Rana V, et al. On-site enzymes produced from Trichoderma reesei RUT-C30 and Aspergillus saccharolyticus for hydrolysis of wet exploded corn stover and loblolly pine. Bioresour. Technol. 154: 282-289. 2014. PubMed: 24412480 Marx IJ, et al. Comparative secretome analysis of Trichoderma asperellum S4F8 and Trichoderma reesei Rut C30 during solid-state fermentation on sugarcane bagasse. Biotechnol. Biofuels 6: 172, 2013. PubMed: 24286470 Anderson LN, et al. Activity-based protein profiling of secreted cellulolytic enzyme activity dynamics in Trichoderma reesei QM6a, NG14, and RUT-C30. Mol. Biosyst. 9: 2992-3000, 2013. PubMed: 24121482 Peterson R, Nevalainen H. Trichoderma reesei RUT-C30--thirty years of strain improvement. Microbiology 158: 58-68, 2012. PubMed: 21998163 |