微信小陈
微信小章| 产品名称： | Aspergillus flavus Link |
|---|---|
| 商品货号： | TS205261 |
| Strain Designations： | SN 3 Aust. Mycol. Panel 3, CBS 131.61, DSM 1959, Harvard 997, IFO 6343, IMI 91856, NRRL A-3537, NRRL A-5244, QM 380, RIB 1403 |
| Application： | Assay of wood preservative compounds Bacterial resistance testing adhesives Deacylates Fungus resistance testing Fungus resistance testing adhesives Fungus resistance testing airborne equipment Fungus resistance testing aircraft transmissions Fungus resistance testing automotive components Fungus resistance testing cork Fungus resistance testing electrical insulation Fungus resistance testing packing materials Fungus resistance testing varnish Fungus resistance testing wax Produces blasticidin S deaminase Testing fungicides on lumber Reference strain for performance testing culture media listed by the ISO TC 34 SC 9 Joint Working Group 5 in the ISO 11133 and by the Working Party on Culture Media of the International Committee on Food Microbiology and Hygiene (ICFMH-WPCM) This strain is recommended by ATCC for use in the tests described in RF31871 where only the taxon is specified. |
| Biosafety Level： | 1
Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country. |
| Product Format： | freeze-dried |
| Storage Conditions： | Frozen: -80°C or colder Freeze-Dried: 2°C to 8°C Live Culture: See Propagation Section |
| Type Strain： | no |
| Preceptrol®： | no |
| Comments： | Aflatoxin not produced |
| Morphology： | After 6 says on Potato dextrose medium at 25°C, colony is low, white, cottony, becoming green with sporulation. Conidial heads radiate; stipes hyaline, smooth-walled; vesicles globose with metulae or phialides covering nearly the entire surface of the vesicle; variably seriate. Conidia subglobose, smooth-walled, green. |
| Medium： | ATCC® Medium 312: Czapeks agar ATCC® Medium 336: Potato dextrose agar (PDA) ATCC® Medium 307: Cornmeal agar |
| Growth Conditions： | Temperature: 24°C to 26°C Atmosphere: Typical aerobic |
| Sequenced Data： |
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence
AAGGATCATTACCGAGTGTAGGGTTCCTAGCGAGCCCAACCTCCCACCCGTGTTTACTGTACCTTAGTTGCTTCGGCGGGCCCGCCATTCATGGCCGCCGGGGGCTCTCAGCCCCGGGCCCGCGCCCGCCGGAGACACCACGAACTCTGTCTGATCTAGTGAAGTCTGAGTTGATTGTATCGCAATCAGTTAAAACTTTCAACAATGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAACTAGTGTGAATTGCAGAATTCCGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTGCTGCCCATCAAGCACGGCTTGTGTGTTGGGTCGTCGTCCCCTCTCCGGGGGGGACGGGCCCCAAAGGCAGCGGCGGCACCGCGTCCGATCCTCGAGCGTATGGGGCTTTGTCACCCGCTCTGTAGGCCCGGCCGGCGCTTGCCGAACGCAAATCAATCTTTTTCCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATA |
| Name of Depositor： | WH Weston |
| Isolation： | Shoe sole, New Guinea |
| Cross References： | Nucleotide (GenBank) : HQ026738 ITS including 5.8S rRNA gene |
| References： | Kumeda Y, Asao T. Single-strand conformation polymorphism analysis of PCR-amplified ribosomal DNA internal transcribed spacers to differentiate species of Aspergillus section Flavi. Appl. Environ. Microbiol. 62: 2947-2952, 1996. PubMed: 8702288 ASTM International Standard Test Methods for Ability of Adhesive Films to Support or Resist the Growth of Fungi. West Conshohocken, PA:ASTM International;ASTM Standard Test Method D 4300-01. ASTM International Standard Test Methods for Resistance of Adhesive Preparations in Container to Attack by Bacteria, Yeast, and Fungi. West Conshohocken, PA:ASTM International;ASTM Standard Test Method D 4783-01e1. RTCA Environmental conditions and test procedures for airborne equipment -- Fungus resistance. Washington, DC:RTCA;RTCA DO-160C. U.S. Department of Defense Insulation, electrical, synthetic-resin composition, nonrigid. Washington, DC:US Department of Defense;Military Specification MIL-I-631D, 1961 U.S. Department of Defense Wax, impregnating, waterproofing, for laminated paper tubes for small arms ammunition. Washington, DC:US Department of Defense;Military Specification MIL-W-10885B, 1956 U.S. Department of Defense Environmental test methods and engineering guidelines. Washington, DC:US Department of Defense;Military Standard MIL-STD-810F, 2000 Schmidt E, French DW. Two-day mold testing using a contact agar method. For. Prod. J. 29: 39-42, 1979. Yamaguchi I, et al. Isolation and purification of blasticidin S deaminase from Aspergillus terreus. J. Antibiot. 28: 7-14, 1975. PubMed: 236272 Standard Specification for Cellulosic Fiber Loose-Fill Thermal Insulation. West Conshohocken, PA:ASTM International;ASTM Standard Test Method C 0739-05be1. Standard Specification for Self-Supported Spray Applied Cellulosic Thermal Insulation. West Conshohocken, PA:ASTM International;ASTM Standard Test Method C 1149-06e1. Standard Test Method for Determining Fungi Resistance of Insulation Materials and Facings. West Conshohocken, PA:ASTM International;ASTM Standard Test Method C 1338-00. Adhesives for load-bearing timber structures --- Casein adhesives --- Classification and performance requirements, Annex B. London, UK:British Standards Institution;British Standard BS EN 12436:2002. Kiyota T, et al. Aflatoxin non-productivity of Aspergillus oryzae caused by loss of function in the aflJ gene product. J. Biosci. Bioeng. 111: 512-517, 2011. PubMed: 21342785 |