微信小陈
微信小章| 产品名称： | Fusarium venenatum Nirenberg |
|---|---|
| 商品货号： | TS205486 |
| Deposited As： | Fusarium graminearum Schwabe |
| Strain Designations： | I 0/5 A 3/5, IMI 145425, NRRL 26139 |
| Application： | Produces alkaline protease
Produces single-cell protein SCP
Transformation host
Produces edible mycoprotein |
| Biosafety Level： | 1
Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country. |
| Product Format： | frozen |
| Storage Conditions： | Frozen: -80°C or colder Freeze-Dried: 2°C to 8°C Live Culture: See Propagation Section |
| Type Strain： | no |
| Disclosure： | This material is cited in a US or other Patent and may not be used to infringe the claims. Depending on the wishes of the Depositor, ATCC may be required to inform the Patent Depositor of the party to which the material was furnished. This material may not have been produced or characterized by ATCC. |
| Preceptrol®： | no |
| Comments： | Taxonomy |
| Morphology： | After 13 days on Malt agar medium at 30°C, colonies are restricted, heaped, pale orange. No sporulation observed. After 7 days on Emmons modification of Sabourauds agar at room temperature with a natural day/night cycle, colony is thick, velutinous, pale orange. Macroconidia abundant, falcate, 5-septate. |
| Medium： | ATCC® Medium 323: Malt agar medium ATCC® Medium 325: Malt extract agar (Blakeslees formula) ATCC® Medium 28: Emmons modification of Sabourauds agar |
| Growth Conditions： | Temperature: 25°C to 30°C
Atmosphere: Typical aerobic |
| Sequenced Data： |
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence
GGTCTCCGTTGGTGAACCAGCGGAGGGATCATTACCGAGTTTACAACTCCCAAACCCCTGTGAACATACCTCTATGTTGCCTCGGCGGATCAGCCCGTTCCTCACGGAACGGCCCGCCGCAGGACCCCTAAACTCTGTTTTTAGTGGAACTTCTGAGTAAAAAAACAAATAAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCAAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGTATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCCCAGCTTGGTGTTGGGAGCTGTTTTAGTTAACACTCCCCAAATTGATTGGCGGTCACGTCGAGCTTCCATAGCGTAGTAATTTACACATCGTTACTGGTAATCGACGCGGCCACGCCGTTAAACCCCAACTTCTGAATGTTGACCTCGGATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAA D1D2 region of the 28S ribosomal RNA gene ATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTTTCGGGCCCGAGTTGTAATTTGTAGAGGATGACTTTGATGCGGTGCCTTCCGAGTTCCCTGGAACGGGACGCCATAGAGGGTGAGAGCCCCGTCTGGTTGGATGCCAAATCTCTGTAAGTCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTATATGTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGTTTATGACCAGACTTGGGCTTGGTTAATCATCTGGGGTTCTCCCCAGTGCACTTTTCCAGTCCAGGCCAGCATCAGTTTTCGCCGGGGGATAAAGACTTCGGGAATGTGGCTCCTCTCGGGGAGTGTTATAGCCCGTTGTGTAATACCCTGGCGGGGACTGAGGTTCGCGCTTCTGCAAGGATGCTGGCGTAATGGTCATCAACGAC |
| Name of Depositor： | RHM Res., Ltd. |
| U.S. Patent Number： | |
| Chain of Custody： | ATCC |
| Isolation： | Soil, United Kingdom |
| Cross References： | Nucleotide (GenBank) : EU853843 ITS including 5.8S rRNA gene Nucleotide (GenBank) : FJ746660 ITS including 5.8S rRNA gene |
| References： | Solomons GL, Scamml GW. Production of edible protein substances. US Patent 3,937,654 dated Feb 10 1976 Towersey PJ, et al. Production of edible protein containing substances. US Patent 3,937,693 dated Feb 10 1976 . . Milchwissenschaft 47: 147-148, 1992. Royer JC, et al. Fusarium graminearum A 3/5 as a novel host for heterologous protein production. Bio-Technology 13: 1479-1483, 1995. PubMed: 9636307 ODonnell K, et al. Molecular phylogenetic, morphological, and mycotoxin data support reidentification of the Quorn mycoprotein fungus as Fusarium venenatum. Fungal Genet. Biol. 23: 57-67, 1998. PubMed: 9501477 Yoder WT, Christianson LM. Species-specific primers resolve members of Fusarium section Fusarium. Taxonomic status of the edible "Quorn" fungus reevaluated. Fungal Genet Biol 23: 68-80, 1998. PubMed: 9501478 |