微信小陈
微信小章| 产品名称： | Aspergillus westerdijkiae Frisvad et Samson |
|---|---|
| 商品货号： | TS205712 |
| Deposited As： | Aspergillus ochraceus Wilhelm |
| Strain Designations： | NRRL 3174 MUCL 39539, CBS 112803 |
| Application： | Produces 10-hydroxyochratoxin A
Produces 4-R-hydroxyochratoxin A
Produces 4-R-hydroxyochratoxin B
Produces 4-hydroxymellein
Produces antifungal antibiotic L-657,398 L-657,398
Produces ochratoxin
Produces ochratoxin A
Produces ochratoxin alpha
Produces ochratoxin beta
Transformation of sesquiterpene lactone costunolide |
| Biosafety Level： | 1
Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country. |
| Product Format： | freeze-dried |
| Storage Conditions： | Frozen: -80°C or colder Freeze-Dried: 2°C to 8°C Live Culture: See Propagation Section |
| Type Strain： | yes |
| Preceptrol®： | no |
| Genome Sequenced Strain： | Yes |
| Comments： | Toxicity of ochratoxin A Peroxidase activity Radiation resistance Genome sequencing strain (EMR Apple Breeding Consortium, UK) |
| Medium： | ATCC® Medium 312: Czapeks agar ATCC® Medium 325: Malt extract agar (Blakeslees formula) ATCC® Medium 336: Potato dextrose agar (PDA) |
| Growth Conditions： | Temperature: 24°C to 26°C
Atmosphere: Typical aerobic |
| Sequenced Data： |
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence
CATTACTGAGTGAGGGTCCCTCGGGGCCCAACCTCCCACCCGTGTATACCGTACCTTGTTGCTTCGGCGAGCCCGCCCCCCTTCCTTAGGGGTGGCACAGCGCTCGCCGGAGACACCAACGTGAACACTGTCTGAAGTTTTGTCGTCTGAGTCGATTGTATCGCAATCAGTTAAAACTTTCAACAATGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAATTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCACCCCCTGGTATTCCGGGGGGTATGCCTGTCCGAGCGTCATTGCTGCCCTCAAGCACGGCTTGTGTGTTGGGTCGTCGTCCCCCCCGGGGGACGGGCCCGAAAGGCAGCGGCGGCACCGCGTCCGGTCCTCGAGCGTATGGGGCTTTGTCACCCGCTCTTGTAGGCCCGGCCGGCTGCTGGCCGACGCTGAAAAGCAACCAATCTATTTCATCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAG D1D2 region of the 28S ribosomal RNA gene AATAAGCGGAGGAAAAGAAACCAACCGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAAGAGCTCAAATTTGAAATCTGGCCCCCTCGGGGTCCGAGTTGTAATTTGCAGAGGATGCTTCGGGTGCGGCCCCCGTCTAAGTGCCCTGGAACGGGCCGTCATAGAGGGTGAGAATCCCGTCTGGGACGGGGTGTCCGCGTCCGTGTGAAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATACTGGCCGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCGACCAGACTCGCCCGCGGGGTTCAGCCGGCATTCGTGCCGGTGTACTTCCCCGTGGGCGGGCCAGCGTCGGTTTGGGCGGCCGGTCAAAGGCCTCCGGAATGTAGCACCCTTCGGGGTGCCTTATAGCCGGGGGTGCAATGCGGCCAGCCTGGACCGAGGAACGCGCTTCGGCACGGACGCTGGCATAATGGTCGTAAACG |
| Name of Depositor： | DI Fennell |
| Cross References： | Nucleotide (GenBank) : LKBE00000000 Aspergillus westerdijkiae strain CBS 112803, whole genome shotgun sequencing project |
| References： | Visagie CM, et al. Ochratoxin production and taxonomy of the yellow aspergilli (Aspergillus section Circumdati). Stud. Mycol. 78: 1–61, 2014. PubMed: 25492980 Frisvad JC, et al. New ochratoxin A producing species of Aspergillus section Circumdati. Stud. Mycol. 50: 23–43, 2004. Xiao H, et al. Metabolites of ochratoxins in rat urine and in a culture of Aspergillus ochraceus. Appl. Environ. Microbiol. 62: 648-655, 1996. PubMed: 8593066 Paster N, et al. Effect of gamma radiation on ochratoxin production by the fungus Aspergillus ochraceus. J. Sci. Food Agric. 36: 445-449, 1985. Schwartz RE, et al. L-657,398, a novel antifungal agent: fermentation, isolation, structural elucidation and biological properties. J. Antibiot. 41: 1774-1779, 1988. PubMed: 3209471 El-Gendy SM, Marth EH. Heat-stability of peroxidase in mycelia of some toxigenic and nontoxigenic aspergilli and penicillia. Mycopathologia 73: 25-28, 1981. PubMed: 6783912 Clark AM, Hufford CD. Microbial transformations of the sesquiterpene lactone costunolide. J. Chem. Soc. Perkin Trans. 1979: 3022-3028, 1979. Sansing GA, et al. Rapid method for preparing cell-free extracts of Aspergillus ochraceus. Appl. Microbiol. 29: 300-302, 1975. PubMed: 1115500 Wu MT, Ayres JC. Effects of dichlorvos on ochratoxin production by Aspergillus ochraceus. J. Agric. Food Chem. 22: 536-537, 1974. PubMed: 4840523 Doster RC, et al. Comparative toxicity of ochratoxin A and crude Aspergillus ochraceus culture extract in Japanese quail (Coturnix coturnix japonica). Poultry Sci. 52: 2351-2353, 1973. PubMed: 4789009 Cole RJ, et al. 4-Hydroxymellein: a new metabolite of Aspergillus ochraceus. J. Agric. Food Chem. 19: 909-911, 1971. Davis ND, et al. Production of ochratoxin A by Aspergillus ochraceus in a semisynthetic medium. Appl. Microbiol. 17: 742-744, 1969. PubMed: 5785958 Searcy JW, et al. Biosynthesis of ochratoxin A. Appl. Microbiol. 18: 622-627, 1969. PubMed: 5369298 Bacha N, et al. Cloning and characterization of novel methylsalicylic acid synthase gene involved in the biosynthesis of isoasperlactone and asperlactone in Aspergillus westerdijkiae. Fungal Genet Biol 46: 742-749, 2009. PubMed: 19589392 Gil-Serna J, et al. Discrimination of the main Ochratoxin A-producing species in Aspergillus section Circumdati by specific PCR assays. Int J Food Microbiol 136: 83-87, 2009. PubMed: 19819579 Peterson SW. Phylogenetic analysis of Aspergillus species using DNA sequences from four loci. Mycologia 100: 205-226, 2008. PubMed: 18595197 Varga J, et al. Molecular analysis of variability within the toxigenic Aspergillus ochraceus species. Can J Microbiol 46: 593-599, 2000. PubMed: 10932351 |