| 产品名称: | Wickerhamomyces canadensis (Wickerham) Kurtzman et al. |
|---|---|
| 商品货号: | TS207519 |
| Deposited As: | Hansenula wingei Wickerham |
| Strain Designations: | YB-4662-VIA |
| Biosafety Level: | 1
Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country. |
| Product Format: | freeze-dried |
| Storage Conditions: | Frozen: -80°C or colder Freeze-Dried: 2°C to 8°C Live Culture: See Propagation Section |
| Type Strain: | no |
| Preceptrol®: | no |
| Mating Type: | type 21 |
| Ploidy: | haploid |
| Comments: | poor agglutination |
| Medium: | ATCC® Medium 200: YM agar or YM broth ATCC® Medium 28: Emmons modification of Sabourauds agar ATCC® Medium 1245: YEPD |
| Growth Conditions: | Temperature: 24°C to 26°C Atmosphere: Typical aerobic |
| Sequenced Data: | 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence.
GGCTGGCAGCATCTGCAGAGGGCTATAACACAGCTGCCAAAGACAGCTGCCACGTTCCCCCTACCATTATCCTGCCGCTCCGAATCGATGCTGGCCCAGCGCACGCCGAGTACACAACCCACAAGGGGAAGCTAATCAACCGCACACCAAGTCTGATCTAATACCCTTCCCTTTCAACAATTTCACGTACTTTTTCACTCTCTTTTCAAAGTTCTTTTCATCTTTCCATCACTGTACTTGTTCGCTATCGGTCTCTCGCCAATATTTAGCTTTAGATGGAATTTACCACCCACTTAGAGCTGCATTCCCAAACAACTCGACTCGTCGAAGGCACTGTACAAAGAGCTGGGTCACCTCATCAGACGGGATTCTCACCCTCTGTGACGTCCTGTTCCAAGGAACATAGATAAAGGCCAGCCCCACAGTCGCCATCTTCAAATTACAACTCGGACACCCAAGAAGGGCGCCAGATTTCAAATTTGAGCTTTTGCCGCTTCACTCGCCGTTACTGAGGCAATCCCTGTTG |
| Name of Depositor: | M Crandall |
| Chain of Custody: | ATCC |
| Cross References: | Nucleotide (GenBank) : GU256763 D1/D2 region of 28S rRNA gene |
| References: | Crandall MA, Brock TD. Molecular basis of mating in the yeast hansenula wingei. Bacteriol. Rev. 32: 139-163, 1968. PubMed: 4879235 Crandall M. Comparison of Hansenula wingei, a petite-negative, obligately aerobic yeast, to the petite-positive yeast Saccharomyces cerevisiae. J. Gen. Microbiol. 75: 363-375, 1973. PubMed: 4574920 Crandall M, Richter RH. Genetics of resistance to ethidium bromide in the petite-negative yeast Hansenula wingei. Mol. Gen. Genet. 125: 279-293, 1973. PubMed: 4777789 |