微信小陈
微信小章| 产品名称： | Xanthophyllomyces dendrorhous Golubev |
|---|---|
| 商品货号： | TS207637 |
| Deposited As： | Phaffia rhodozyma Miller et al. |
| Strain Designations： | UCD 67-210 ATCC 96587, CBS 5905, CCRC 21346, CCY 77-1-1, DSM 5626, IFO 10129, IGC 4172, NCYC 874, NRRL Y-10921 |
| Synonym： | Phaffia rhodozyma Miller et al. |
| Application： | Produces astaxanthin
Produces carotenoids
Produces glycoproteins
Increased production of carotinoids and trans-astaxanthin by addition of mevalonic acid |
| Biosafety Level： | 1
Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country. |
| Product Format： | freeze-dried |
| Storage Conditions： | Frozen: -80°C or colder Freeze-Dried: 2°C to 8°C Live Culture: See Propagation Section |
| Type Strain： | yes (type strain of Phaffia rhodozyma) |
| Preceptrol®： | no |
| Comments： | Taxonomy Cryopreservation Psychrophilic |
| Medium： | ATCC® Medium 200: YM agar or YM broth ATCC® Medium 323: Malt agar medium ATCC® Medium 337: Potato, dextrose, yeast agar (PDY) |
| Growth Conditions： | Temperature: 20°C Atmosphere: Typical aerobic |
| Sequenced Data： |
D1D2 region of the 26S ribosomal RNA gene ATATCAATAAGCGGAGGAAAAGAAACTAACAAGGATTCCCCTAGTAACGGCGAGTGAAGCGGGATGAGCTCAAATTTGAAATCTGGCAGCCTCCGGTTGTCCGAGTTGTAAACTAGAGAAGCGTTTTCCGTGCCGGCCTGTGTACAAGTCCCTTGGAATAGGGCGTCATAGAGGGTGAGAATCCCGTCCTTGACACAGACCACCGGTGCTATGTGATACGCTCTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAATTGGGTGGTAAATTCCATCTAAGGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACGATTGAAGTCAGTCATGCGTGCTCGGACTCAGCTGGGTTCGTCCCAGTCTATTTCCGGGTGCCGCAGGTCAGCATCAGTTTCGGGCGGTGGAAAACGGGCGGGGGAAGGTGGCATCTCCGGATGTGTTATAGCCCCCGTTTGGATGCATCGCGTGGGACTGAGGAACGCAGCGCGCCCTTCACGGGGTCGGTCTCCGGACACGAACGCGCTTAGGATGCTGGCATAATGGCTTTAAACGAC |
| Name of Depositor： | HJ Phaff |
| Isolation： | Fagus crenata, Kyoto, Japan |
| Cross References： | Nucleotide (GenBank) : AF139634 nucleotide sequence of intergenic spacer Nucleotide (GenBank) : AF189871 26S ribosomal RNA gene, partial sequence Nucleotide (GenBank) : AF139629 nucleotide sequence of internal transcribed spacer |
| References： | Johnson EA, et al. Processes for in vivo production of astaxanthin and Phaffia rhodozyma yeast of enhanced astaxanthin content. US Patent 5,356,809 dated Oct 18 1994 Golubev WI. Perfect state of Rhodomyces dendrorhous (Phaffia rhodozyma). Yeast 11: 101-110, 1995. PubMed: 7732720 Miller MW, et al. Phaffia, a new yeast genus in the Deuteromycotina (Blastomycetes). Int. J. Syst. Bacteriol. 26: 286-291, 1976. . . Biotechnol. Lett. 17: 575-578, 1995. Hayman GT, et al. Production of carotenoids by Phaffia rhodozyma grown on media composed of corn wet-milling co-products. J. Ind. Microbiol. 14: 389-395, 1995. Tilser I, et al. Effect of supplementation of University of Wisconsin solution with glycoproteins from psychrophilic strains of yeast on hypothermic liver storage of rats. Cryobiology 33: 347-353, 1996. PubMed: 8689892 Breierova E. Cryoprotection of psychrophilic yeast species- by the use of additives with croprotective media. Cryo-Lett. 15: 191-197, 1994. Fell JW, Blatt GM. Separation of strains of the yeasts Xanthophyllomyces dendrorhous and Phaffia rhodozyma based on rDNA IGS and ITS sequence analysis. J. Ind. Microbiol. Biotechnol. 23: 677-681, 1999. PubMed: 10455500 Fell JW, et al. Biodiversity and systematics of basidiomycetous yeasts as determined by large-subunit rDNA D1/D2 domain sequence analysis. Int. J. Syst. Evol. Microbiol. 50: 1351-1371, 2000. PubMed: 10843082 Calo P, et al. Mevalonic acid increases trans-astaxanthin and carotenoid biosynthesis in Phaffia rhodozyma. Biotechnol Lett 17: 575-578, 1995. David-Palma M, Libkind D, Sampaio JP. Global distribution, diversity hot spots and niche transitions of an astaxanthin-producing eukaryotic microbe. Mol Ecol 23: 921-932, 2014. PubMed: 24372735 Hara KY, et al. Evaluation and screening of efficient promoters to improve astaxanthin production in Xanthophyllomyces dendrorhous. Appl Microbiol Biotechnol 98: 6787-6793, 2014. PubMed: 24737060 Loto I, et al. Enhancement of carotenoid production by disrupting the C22-sterol desaturase gene (CYP61) in Xanthophyllomyces dendrorhous. BMC Microbiol 12: 235, 2012. PubMed: 23075035 Linde D, et al. Molecular and biochemical characterization of a beta-fructofuranosidase from Xanthophyllomyces dendrorhous. Appl Environ Microbiol 75: 1065-1073, 2009. PubMed: 19088319 Libkind D, et al. Biogeography, host specificity, and molecular phylogeny of the basidiomycetous yeast Phaffia rhodozyma and its sexual form, Xanthophyllomyces dendrorhous. Appl Environ Microbiol 73: 1120-1125, 2007. PubMed: 17189439 Fell JW, et al. Molecular diversity and intragenomic variability in the yeast genus Xanthophyllomyces: the origin of Phaffia rhodozyma? FEMS Yeast Res 7: 1399-1408, 2007. PubMed: 17825066 type strain of Phaffia rhodozyma |