微信小陈
微信小章| 产品名称： | Malassezia furfur (Robin) Baillon |
|---|---|
| 商品货号： | TS207693 |
| Deposited As： | Pityrosporum ovale (Bizzozero) Castellani et Chalmers |
| Strain Designations： | CBS 1878 IFO 0656, NRRL 3176 |
| Application： | Biomedical Research and Development Material |
| Biosafety Level： | 2
Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country. |
| Product Format： | freeze-dried |
| Storage Conditions： | Frozen: -80°C or colder Freeze-Dried: 2°C to 8°C Live Culture: See Propagation Section |
| Type Strain： | yes (Neotype of Pityrosporum ovale) |
| Preceptrol®： | no |
| Genome Sequenced Strain： | Yes |
| Comments： | Genome sequencing strain (Genome Institute of Singapore, Singapore) |
| Morphology： | Colonies after 10 days on mDixon agar are cream-colored dull, smooth with convex elevation. Cells are oval, cylindrical or spherical, single or pairs and budding, occasionally forming short chains. |
| Medium： | ATCC® Medium 2693: modified Dixon (mDixon) ATCC® Medium 2737: Modified Leeming & Notman Agar (MLNA) ATCC® Medium 1072: Pityrosporum medium |
| Growth Conditions： | Temperature: 30°C Atmosphere: Typical aerobic |
| Sequenced Data： |
D1D2 region of the 26S ribosomal RNA gene ATATCATTAAGCGGAGGAAAAGAAACTAACAAGGATTCCCCTAGTAACGGCGAGTGAAGAGGGAAGAGCTCAAATTTGAAAGCTGGTACCTTCGGTATCCGCGTTGTAACCTCGAGACACGTTTTCCGTGCGGCGCTATGGACAAGTTCCTTGGAACAGGACATCGTAGAGGGTGAAAATCCCGTACTTGCCATGGATGTACCGTGCTTTGCGATACGTGCTCTAAGAGTCGAGTTGTTTGGGATTGCAGCTCAAAATGGGTGGTAGACTCCATCTAAAGCTAAATATCGGGGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAGTACGTGAAATTGTCGAAAGGGAAGCGCTTGAAGTCAGCCATGCCGCTCAGGACTCAGCCTGGCTTTTGCTTGGTGTATTTCCTGGGTAGCAAGTCAGCATTGGTTTGGATCGTCGGAGAAGCATAGTCGGAATGTGGCGCCCTCGGGCGTGTTATAGCCTTCTATTGGATACGACGATCTAGACCAAGGAACGCAGCGCGCCTTATGGCGGGTCTTCGGACACCTTCGCGCTTAGGATGCTGGCGTAATGGCTTTAAGTGGC |
| Name of Depositor： | CBS |
| Chain of Custody： | ATCC <-- CBS <-- RW Benham |
| Cross References： | Nucleotide (GenBank) : KU729140 D1/D2 region of 26S rRNA gene |
| References： | Benham RW. The cultural characteristics of Pityrosporum ouale. A lipophilic fungus. J Invest Dermatol 2: 187–203, 1939. Benham RW. The cultural characteristics of Pityrosporum ovale. A lipophilic fungus. Nutrient and growth requirements. Proc Soc Exp Biol Med 46: 176-178, 1941. Benham RW. Pityrosporum ovale. A lipophilic fungus. Thiamin and oxaloacetic acid as growth factors. Proc Soc Exp Biol Med 58: 199-201, 1945. Lodder J. The yeasts: a taxonomic study. 2nd ed. Amsterdam: North-Holland; 1970. Castellá G, Coutinho SD, Cabañes FJ. Phylogenetic relationships of Malassezia species based on multilocus sequence analysis. Med. Mycol. 52: 99-105, 2014. PubMed: 23902157 Cafarchia C, et al. Physiological and molecular characterization of atypical lipid-dependent Malassezia yeasts from a dog with skin lesions: adaptation to a new host? Med Mycol 49: 365-374, 2011. PubMed: 21070187 Gonzalez A, et al. Physiological and molecular characterization of atypical isolates of Malassezia furfur. J Clin Microbiol 47: 48-53, 2009. PubMed: 18971363 Cabañes FJ, et al. Two New lipid-dependent Malassezia species from domestic animals. FEMS Yeast Res. 7(6): 1064-1076, 2007. PubMed: 17367513 Brunke S, Hube B. MfLIP1, a gene encoding an extracellular lipase of the lipid-dependent fungus Malassezia furfur. Microbiology 152: 547-554, 2006. PubMed: 16436442 Matheny PB, et al. Resolving the phylogenetic position of the Wallemiomycetes: an enigmatic major lineage of Basidiomycota. Can J Bot 84: 1794-1805, 2006. Cabanes FJ, Hernandez JJ, Castella G. Molecular analysis of Malassezia sympodialis-related strains from domestic animals. J Clin Microbiol 43: 277-283, 2005. PubMed: 15634983 Gupta AK, et al. Identification and typing of Malassezia species by amplified fragment length polymorphism and sequence analyses of the internal transcribed spacer and large-subunit regions of ribosomal DNA. J Clin Microbiol 42: 4253-4260, 2004. PubMed: 15365020 Guillot J, et al. Confirmation of the nomenclatural status of Malassezia pachydermatis. Antonie van Leeuwenhoek 67: 173-176, 1995. PubMed: 7771764 Guillot J, Gueho E. The diversity of Malassezia yeasts confirmed by rRNA sequence and nuclear DNA comparisons. Antonie van Leeuwenhoek 67: 297-314, 1995. PubMed: 7778898 Gueho E, Meyer SA. A reevaluation of the genus Malassezia by means of genome comparison. Antonie van Leeuwenhoek 55: 245-251, 1989. PubMed: 2757367 Neotype of Pityrosporum ovale |