微信小陈
微信小章| 产品名称： | Saccharomyces cerevisiae Meyen ex E.C. Hansen |
|---|---|
| 商品货号： | TS207764 |
| Deposited As： | Saccharomyces cerevisiae Hansen |
| Classification： | Saccharomycetes, Saccharomycetidae, Saccharomycetales, Saccharomycetaceae, Saccharomycetaceae, Saccharomyces, cerevisiae |
| Strain Designations： | S288C MUCL 38902 |
| Alternate State： | Candida robusta Diddens et Lodder |
| Application： | Degrades molasses
Produces chitin synthetase zymogen
Produces esterase
Produces fructose 1,6-diphosphate
Produces methionine specific tRNA
Produces pyrimidine-specific endoribonuclease
Transformation host
Produces: fructose 1,6-diphosphate from molasses |
| Biosafety Level： | 1
Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country. |
| Product Format： | freeze-dried |
| Storage Conditions： | Frozen: -80°C or colder Freeze-Dried: 2°C to 8°C Live Culture: See Propagation Section |
| Type Strain： | no |
| Genotype： | MATalpha sta1 sta2 sta3 STA10 |
| Preceptrol®： | no |
| Mating Type： | alpha |
| Ploidy： | haploid |
| Comments： | Chromosomal rearrangements
ITS-PCR ribotyping
Potassium ions increase the susceptibility to fluconazole
Ribosome-binding assay
Structure of ribosomal subunits
Wild type |
| Morphology： | On YM medium at 25°C after 3 days, colonies creamy white to dingy white, dull, margin entire. Cells globose to subglobose, smooth, guttulate, 4.5-9.0 X 3.0-8.3 µm. |
| Medium： | ATCC® Medium 28: Emmons modification of Sabourauds agar ATCC® Medium 200: YM agar or YM broth ATCC® Medium 1245: YEPD |
| Growth Conditions： | Temperature: 24°C to 26°C
Atmosphere: Typical aerobic |
| Sequenced Data： |
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence GGTTTCCGTAGGTGAACCTGCGGAAGGATCATTAAAGAAATTTAATAATTTTGAAAATGGATTTTTTTGTTTTGGCAAGAGCATGAGAGCTTTTACTGGGCAAGAAGACAAGAGATGGAGAGTCCAGCCGGGCCTGCGCTTAAGTGCGCGGTCTTGCTAGGCTTGTAAGTTTCTTTCTTGCTATTCCAAACGGTGAGAGATTTCTGTGCTTTTGTTATAGGACAATTAAAACCGTTTCAATACAACACACTGTGGAGTTTTCATATCTTTGCAACTTTTTCTTTGGGCATTCGAGCAATCGGGGCCCAGAGGTAACAAACACAAACAATTTTATCTATTCATTAAATTTTTGTCAAAAACAAGAATTTTCGTAACTGGAAATTTTAAAATATTAAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCAGGGGGCATGCCTGTTTGAGCGTCATTTCCTTCTCAAACATTCTGTTTGGTAGTGAGTGATACTCTTTGGAGTTAACTTGAAATTGCTGGCCTTTTCATTGGATGTTTTTTTTCCAAAGAGAGGTTTCTCTGCGTGCTTGAGGTATAATGCAAGTACGGTCGTTTTAGGTTTTACCAACTGCGGCTAATCTTTTTTTATACTGAGCGTATTGGAACGTTATCGATAAGAAGAGAGCGTCTAGGCGAACAATGTTCTTAAAGTTTGACCTCAAATCAGGTAGGAGTAC D1D2 region of the 26S ribosomal RNA gene ATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGTACCTTCGGTGCCCGAGTTGTAATTTGGAGAGGGCAACTTTGGGGCCGTTCCTTGTCTATGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTGTGGCGAGGAGTGCGGTTCTTTGTAAAGTGCCTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACAGTGATGGAAAGATGAAAAGAACTTTGAAAAGAGAGTGAAAAAGTACGTGAAATTGTTGAAAGGGAAGGGCATTTGATCAGACATGGTGTTTTGTGCCCTCTGCTCCTTGTGGGTAGGGGAATCTCGCATTTCACTGGGCCAGCATCAGTTTTGGTGGCAGGATAAATCCATAGGAATGTAGCTTGCCTCGGTAAGTATTATAGCCTGTGGGAATACTGCCAGCTGGGACTGAGGACTGCGACGTAAGTCAAGGATGCTGGCATAATGGTTATATGCCGC |
| Name of Depositor： | E Cabib |
| Chain of Custody： | ATCC |
| References： | Stevens A. Pyrimidine-specific cleavage by an endoribonuclease of Saccharomyces cerevisiae. J. Bacteriol. 164: 57-62, 1985. PubMed: 3900048 Inoue Y, et al. Lipid hydroperoxide-resistance gene in Saccharomyces cerevisiae: utilization as a selectable marker gene for yeast transformation. Biotechnol. Appl. Biochem. 17: 305-310, 1993. PubMed: 8338639 Poliana J, Wiggs MY. STA10: A gene involved in the control of starch utilization by Saccharomyces. Curr. Genet. 7: 109-112, 1983. PubMed: 24173151 Kyle KM, Harauz G. Structure of ribosomal subunits from Saccharomyces cerevisiae. Micron Microsc. Acta 23: 273-286, 1992. Mitra SK, et al. Specificity of AAG codon recognition by lysyl transfer ribonucleic acid from yeast. J. Biol. Chem. 246: 5854-5856, 1971. PubMed: 4938043 Sagliocco F, et al. Identification of proteins of the yeast protein map using genetically manipulated strains and peptide-mass fingerprinting. Yeast 12: 1519-1533, 1996. PubMed: 8972575 Casaregola S, et al. A family of laboratory strains of Saccharomyces cerevisiae carry rearrangements involving chromosomes I and III. Yeast 14: 551-564, 1998. PubMed: 9605505 McCullough MJ, et al. Intergenic transcribed spacer PCR ribotyping for differentiation of Saccharomyces species and interspecific hybrids. J Clin Microbiol 36: 1035-1038, 1998. PubMed: 9542932 Degrassi G, et al. Purification and properties of an esterase from the yeast Saccharomyces cerevisiae and identification of the encoding gene. Appl. Environ. Microbiol. 65: 3470-3472, 1999. PubMed: 10427036 Feldmann H, et al. Methionine specific transfer ribonucleic acids from brewers yeast and a haploid yeast strain. Hoppe-Seylers Z. Physiol. Chem. 352: 1231-1247, 1971. PubMed: 5096067 Stella CA, Burgos HI. Effect of potassium on Saccharomyces cerevisiae resistance to fluconazole. Antimicrob. Agents Chemother. 45: 1589-1590, 2001. PubMed: 11302836 Compagno C, et al. Production of fructose diphosphate by bioconversion of molasses with Saccharomyces cerevisiae cells. Biotechnol. Lett. 14: 495-498, 1992. Cabib E, Ulane R. Chitin synthetase activating factor from yeast, a protease. Biochem. Biophys. Res. Commun. 50: 186-191, 1973. PubMed: 4567083 Hoang ML, et al. Competitive repair by naturally dispersed repetitive DNA during non-allelic homologous recombination. PLoS Genet. 6: e1001228, 2010. PubMed: 21151956 Miura F, et al. A large-scale full-length cDNA analysis to explore the budding yeast transcriptome. Proc Natl Acad Sci USA 103: 17846-17851, 2006. PubMed: 17101987 Fay JC, Benavides JA. Evidence for domesticated and wild populations of Saccharomyces cerevisiae. Plos Genet. 1: e5-e5, 2005. PubMed: 16103919 Deutschbauer AM, Davis RW. Quantitative trait loci mapped to single-nucleotide resolution in yeast. Nat. Genet. 37: 1333-1340, 2005. PubMed: 16273108 Fay JC, et al. Population genetic variation in gene expression is associated with phenotypic variation in Saccharomyces cerevisiae. Genome Biol. 5: R26, 2004. PubMed: 15059259 Marinangeli P, et al. Minisatellites in Saccharomyces cerevisiae genes encoding cell wall proteins: a new way towards wine strain characterization. FEMS Yeast Res. 4: 427-435, 2004. PubMed: 14734023 Leh-Louis V, et al. Expansion and contraction of the DUP240 multigene family in Saccharomyces cerevisiae populations. Genetics 167: 1611-1619, 2004. PubMed: 15342502 Kellis M, et al. Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423: 241-254, 2003. Brachat S, et al. Reinvestigation of the Saccharomyces cerevisiae genome annotation by comparison to the genome of a related fungus: Ashbya gossypii. Genome Biol. 4: R45-R45, 2003. PubMed: 12844361 Muller O, et al. Role of the Vtc proteins in V-ATPase stability and membrane trafficking. J Cell Sci 116: 1107-1115, 2003. PubMed: 12584253 Maruyama R, et al. The enzymes with benzil reductase activity conserved from bacteria to mammals. J. Biotechnol. 94: 157-169, 2002. PubMed: 11796169 Cheeseman IM, et al. Mitotic spindle integrity and kinetochore function linked by the Duo1p/Dam1p complex. J. Cell Biol. 152: 197-212, 2001. PubMed: 11149931 Jensen MA, et al. Molecular population genetics and evolution of a prion-like protein in Saccharomyces cerevisiae. Genetics 159: 527-535, 2001. PubMed: 11606530 |