| 产品名称: | Ganoderma lucidum (Leysser) Karsten |
|---|---|
| 商品货号: | TS208759 |
| Strain Designations: | FRI 55 |
| Application: | cultural diagnosis studies |
| Biosafety Level: | 1
Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country. |
| Product Format: | frozen |
| Type Strain: | no |
| Preceptrol®: | no |
| Comments: | cultural diagnosis studies rapid identification |
| Morphology: | After two weeks at 25°C clamp connections and abundant chlamydospores observed.xa0 The context hyphal system is trimitic; generative hyphae hyaline, thin-walled, branched, 3.5-4.5xa0 µm diam.; skeletal hyphae yellowish brown, thick-walled to solid, arboriform; skeletal stalks 3-5 µm diam, with branches ending in flagelliform binding processes; binding hyphae colorless, thick-walled, sinuous, branched, 1.5-2 µm diam.xa0 |
| Medium: | ATCC® Medium 200: YM agar or YM broth |
| Growth Conditions: | Temperature: 24.0°C |
| Sequenced Data: | 18S ribosomal RNA gene, partial sequence; internalxa0xa0 transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence.
xa0xa0 GAGACTTATACACGGTCCAGCGCGGAAAGCACTTCTCCAGACTACAACTCGGACGGCCAAAGACCGCCAGATTTTAAATTTGAGCTTTTCCCGCTTCACTCGCAGTTACTAGGGGAATCCTTGTAGTTTCTTTTCCTCCGCTTATTGATATGCTTAAGTTCAGCGGGTAGTCCTACCTGATTTGAGGTCAGAGGTCATAAAGTTGTCTCCAACTGAGATGGTTAGAAGCTCGCCAAACGCTTCACGGTCGAGCGTAGACATTATCACACTGAGAGCCGATCCGCAAGGAACCAAGCTAATGCATTTAAGAGGAGCCGACCGAGAACGGCCGACAAGCCTCCAAGTCCAAGCCTACAAACCACAAAAGCTTGCAGGTTAAGATTTCATGACACTCAAACAGGCATGCTCCTCGGAATACCAAGGAGCGCAAGGTGCGTTCAAAGATTCGATGATTCACTGAATTCTGCAATTCACATTACTTATCGCATTTCGCTGCGTTCTTCACGATGCGAGAGCCAAGAGATCCGTTGCTGAAAGTTGTATATAGATGCGTTACATCGCAATACACATTCTGATACTTTATAGAGTTTGTGATAAACGCAGGCACAGACACGCTCCGCAAGCCCGGTAAGGGACCCGTTTTACGATCTGAAGCCCACAGTAAGTGCACAGGTGTAGAGTGGATGAGCAGGGCGTGCACATGCCTCGGAAGGCCAGCTACAACCCAGTCAAAACTCGATAATGATCCTTCCGCAGGTCACCTACGGAAACCTTGTT |
| Name of Depositor: | BK Bakshi |
| Isolation: | Acrocarpus fraxinifolius roots, India |
| Cross References: | Nucleotide (GenBank) : X78744 G.lucidum TS208759 rDNA and ITS 1. Nucleotide (GenBank) : X78765 G.lucidum TS208759 rDNA and ITS 2. Nucleotide (GenBank) : U56122 Ganoderma lucidum manganese-superoxide dismutase (Mn-SOD) gene, Nucleotide (GenBank) : Z37020 G.lucidum ((W.Curt.:Fr.) Karst.) divergent domain D2 of the 25S |
| References: | . . Indian For. Rec. 2: 283, 1973. Hseu RS, Wang HH. Application of hydrolytic enzyme in API-ZYM enzyme testing system to rapid identification of Ganoderma species. J. Chin. Agric. Chem. Soc. 24: 103-109, 1986. J. Chin. Agric. Chem. Soc. 25: 118-124, 1987. J. Chin. Agric. Chem. Soc. 26: 588-596, 1988. Hseu RS, et al. The application of laccase isozyme electrophoretic patterns in the identification of Ganoderma species. J. Chin. Agric. Chem. Soc. 27: 209-217, 1989. |