| 产品名称: | Phanerochaete chrysosporium Burdsall |
|---|---|
| 商品货号: | TS208807 |
| Strain Designations: | ME-446 IFO 31249, PRL 2750 |
| Alternate State: | Sporotrichum pulverulentum Novobranova, Sporotrichum pruinosum Gilman et Abbott |
| Application: | degrades 2,4,5-trichlorophenoxyacetic acid 2,4,5-T degrades 2,4-dichlorophenoxyacetic acid 2,4-D degrades DDT degrades aroclor 1242 degrades aroclor 1254 degrades aroclor 1260 degrades benzene degrades ethylbenzene degrades gentian violet crystal violet degrades pentachlorophenol degrades phenanthrene degrades synthetic lignin degrades toluene degrades veratryl alcohol degrades xylan degrades xylene produces H2O2-dependent oxidase produces NADH-oxidizing peroxidase produces aryl-alcohol oxidase produces cellobiose dehydrogenase produces cellobiose dehydrogenase (quinone) cellobiose:quinone oxidoreductase produces glucose oxidase produces vanillate hydroxylase transformation host produces extracellular NADH-oxidizing peroxidase degrades phenanthrene to trans-dihydrodiols synthesis and degradation of veratryl alcohol converts glyceryl trinitrate to glyceryl 2-mononitrate |
| Biosafety Level: | 1
Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country. |
| Product Format: | freeze-dried |
| Storage Conditions: | Frozen: -80°C or colder Freeze-Dried: 2°C to 8°C Live Culture: See Propagation Section |
| Type Strain: | no |
| Preceptrol®: | no |
| Comments: | requirement for growth substrate during lignin decomposition fruits in culture glucose oxidase as primary source of H2O2 |
| Medium: | ATCC® Medium 200: YM agar or YM broth ATCC® Medium 323: Malt agar medium ATCC® Medium 336: Potato dextrose agar (PDA) |
| Growth Conditions: | Temperature: 24°C to 26°C Atmosphere: Typical
aerobic |
| Sequenced Data: |
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence GGTTTCCGTAGGTGAACCTGCGGAAGGATCATTAACGAGTAACTGAACAGGTTGTAGCTGGCCTCTCGGGGCATGTGCACGCCTGGCTCATCCACTCTTCAACCTCTGTGCACTTGTTGTAGGTCGGTAGAAGAGCGAGCATCCTCTGATGCTTTGCTTGGAAGCCTTCCTATGTTTTACTACAAACGCTTCAGTTTAAGAATGTCTACCTGCGTATAACGCATCTATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCCTGGTATTCCGGGGAGCATGCCTGTTTGAGTGTCATGGTATCCTCAACCTTCATAACTTTTTGTTATCGAAGGCTTGGACTTGGAGGTTGTGCTGGCTTCTAGTCGAGTCGGCTCCTCTTAAATGTATTAGCGTGAGTGTAACGGATCGCTTCGGTGTGATAATTATCTGCGCCGTGGTCGTGAAGTAACATAAGCTTGCGCTTCTAACCGTCCTTCAGTTGGACAACTTACTTTGACATCTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAA D1D2 region of the 28S ribosomal RNA gene ATATCAATAAGCGGAGGAAAAGAAACTAACAAGGATTCCCCTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGCAGTCTTTGGCTGTCCGAGTTGTAATCTGGAGAAGCGTCTTCCGCGCTGGACCGTGTACAAGTCTCCTGGAACGGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAGTGCTCTGTGATGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAACTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGAAGTCAGTCGCGTTTGCTAGGACTCAGCCTGGTTTCGGCCTGGTGCACTTCCTAGTAAACGGGCCAGCATCACTTTTGGCTGCGGGAAAAAGGTTAGAGGAATGTGGCACCCTCGGGTGTGTTATAGCCTCTAGCTGTATACCGTGGCTGGGAGTGAGGAACTCAGCACGCCTTCTGGCGGGGCTTCGGCCACCTTCGTGCTTAGGATGCTGGCGTAATGGCTTTAAACGAC |
| Name of Depositor: | FF Lombard |
| Chain of Custody: | ATCC <-- FF Lombard <-- W.E. Eslyn |
| Isolation: | Rotten beech wood chip, Fagus grandifolia, in storage 4 months, Waterville, ME |
| Cross References: | Nucleotide (GenBank) : Z22527 CBHI.2 gene encoding cellulase Nucleotide (GenBank) : Z22528 CBHI.1 gene encoding cellulase Nucleotide (GenBank) : M22220 exo-cellobiohydrolase I (cbhI) gene, complete coding sequence Nucleotide (GenBank) : Z29653 CBHI.2 mRNA for cellulase |
| References: | Yajima Y, et al. Vanillate hydroxylase from the white rot basidiomycete Phanerochaete chrysosporium. Arch. Microbiol. 123: 319-321, 1979. Kirk TK, et al. Preparation and microbial decomposition of synthetic 14C lignins. Proc. Natl. Acad. Sci. USA 72: 2515-2519, 1975. PubMed: 1058470 Weinstein DA, et al. Metabolism of radiolabeled beta-guaiacyl ether-linked lignin dimeric compounds by Phanerochaete chrysosporium. Appl. Environ. Microbiol. 39: 535-540, 1980. Enoki A, et al. Metabolism of the lignin model compounds veratrylglycerol-beta-guaiacyl ether and 4-ethoxy-3-methoxyphenylglycerol-beta-guaiacyl ether by Phanerochaete chrysosporium. Arch. Microbiol. 125: 227-232, 1980. Kuwahara M. Separation and characterization of two extracellular H2O2-dependent oxidases from ligninolytic cultures of Phanerochaete chrysosporium. FEBS Lett. 169: 247-250, 1984. Kelley RL, Reddy CA. Purification and characterization of glucose oxidase from ligninolytic cultures of Phanerochaete chrysosporium. J. Bacteriol. 166: 269-274, 1986. PubMed: 3957868 Ducrocq C, et al. Formation of glyceryl 2-mononitrate by regioselective bioconversion of glyceryl trinitrates. Efficiency of the filamentous fungus Phanerochaete chrysosporium. Biotechnol. Appl. Biochem. 12: 325-330, 1990. PubMed: 2113815 Randall TA, Reddy CA. The nature of extra-chromosomal maintenance of transforming plasmids in the filamentous basidiomycete Phanerochaete chrysosporium. Curr. Genet. 21: 255-260, 1992. PubMed: 1314140 Copa-Patino JL, et al. Production and initial characterisation of the xylan-degrading system of Phanerochaete chrysosporium. Appl. Microbiol. Biotechnol. 40: 69-76, 1993. . . Appl. Environ. Microbiol. 32: 192-194, 1976. Yadav JS, Reddy CA. Degradation of benzene, toluene, ethylbenzene, and xylenes (BTEX) by the lignin-degrading basidiomycete Phanerochaete chrysosporium. Appl. Environ. Microbiol. 59: 756-762, 1993. PubMed: 8481002 Burdsall HH Jr., Eslyn WE. A new Phanerochaete with a Chrysosporium imperfect state. Mycotaxon 1: 123-133, 1974. Kelley RL, Reddy CA. Identification of glucose oxidase activity as the primary source of hydrogen peroxide production in ligninolytic cultures of Phanerochaete chrysosporium. Arch. Microbiol. 144: 248-253, 1986. Sims PF, et al. Differential expression of multiple exo-cellobiohydrolase I-like genes in the lignin-degrading fungus Phanerochaete chrysosporium. Mol. Microbiol. 12: 209-216, 1994. PubMed: 8057846 Costa-Ferreira M, et al. On the relationship between cellobiose dehydrogenase and cellobiose:quinone oxidoreductase under condtions where 14CDHP is mineralized by whole cultures of Phanerochaete chrysosporium. Enzyme Microb. Technol. 16: 771-776, 1994. Yesilada O. Decolourization of crystal violet by fungi. World J. Microbiol. Biotechnol. 11: 601-602, 1995. Bumpus JA, Aust SD. Biodegradation of DDT 1,1,1-trichloro-2,2-bis(4-chlorophenyl)ethane by the white rot fungus Phanerochaete chrysosporium. Appl. Environ. Microbiol. 53: 2001-2008, 1987. PubMed: 3674869 Dhawale SW, et al. Degradation of phenanthrene by Phanerochaete chrysosporium occurs under ligninolytic as well as nonligninolytic conditions. Appl. Environ. Microbiol. 58: 3000-3006, 1992. PubMed: 1444413 Alleman BC, et al. Toxicity of pentachlorophenol to six species of white rot fungi as a function of chemical dose. Appl. Environ. Microbiol. 58: 4048-4050, 1992. Sutherland JB, et al. Enantiomeric composition of the trans-dihydrodiols produced from phenanthrene by fungi. Appl. Environ. Microbiol. 59: 2145-2149, 1993. Yadav JS, Reddy CA. Mineralization of 2,4-dichlorophenoxyacetic acid (2,4-D) and mixtures of 2,4-D and 2,4,5-trichlorophenoxyacetic acid by Phanerochaete chrysosporium. Appl. Environ. Microbiol. 59: 2904-2908, 1993. Yadav JS, et al. Degradation of polychlorinated biphenyl mixtures (Aroclors 1242, 1254, and 1260) by the white rot fungus Phanerochaete chrysosporium as evidenced by congener-specific analysis. Appl. Environ. Microbiol. 61: 2560-2565, 1995. PubMed: 7618867 Watanabe A, et al. Purification and characterization of an aryl-alcohol oxidase from the lignin-degrading basidiomyte Phanerochaete chrysosporium. Biosci. Biotechnol. Biochem. 59: 1339-1341, 1995. Sims P, et al. The identification, molecular cloning and characterisation of a gene from Phanerochaete chrysosporium that shows strong homology to the exo- cellobiohydrolase I gene from Trichoderma reesei. Gene 74: 411-422, 1988. PubMed: 3246351 Lundquist K, Kirk TK. De novo synthesis and decomposition veratryl alcohol by a lignin-degrading basidiomycete. Phytochemistry 17: 1676, 1978. Asada Y, et al. An extracellular NADH-oxidizing peroxidase produced by a lignin-degrading basidiomycete, Phanerochaete chrysosporium. J. Ferment. Technol. 65: 483-487, 1987. Watanabe T, et al. Characterization of a Delta12-fatty acid desaturase gene from Ceriporiopsis subvermispora, a selective lignin-degrading fungus. Appl Microbiol Biotechnol 87: 215-224, 2010. PubMed: 20155356 Pointing SB, et al. Screening of basidiomycetes and xylariaceous fungi for lignin peroxidase and laccase gene-specific sequences. Mycol Res 109: 115-124, 2005. PubMed: 15736869 Hart DO, et al. Identification of Asp-130 as the catalytic nucleophile in the main alpha-galactosidase from Phanerochaete chrysosporium, a family 27 glycosyl hydrolase. Biochemistry 39: 9826-9836, 2000. PubMed: 10933800 |