微信小陈
微信小章| 产品名称： | Pleurotus eryngii (DeCandolle : Fries) Quelet |
|---|---|
| 商品货号： | TS208820 |
| Strain Designations： | IJFM A-169 CBS 613.91 |
| Application： | Degrades lignin
Produces aryl-alcohol oxidase
Produces beta-(1,3)/beta(1,4)-glucanase
Produces beta-(1,3)/beta(1,6)-glucanase
Produces: ligninolytic peroxidases |
| Biosafety Level： | 1
Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country. |
| Product Format： | frozen |
| Storage Conditions： | Frozen: -80°C or colder Freeze-Dried: 2°C to 8°C Live Culture: See Propagation Section |
| Type Strain： | no |
| Preceptrol®： | no |
| Morphology： | After 7 days on YM medium at 25°C, colony is white, floccose, aerial.xa0 Hyphae hyaline, monomitic, with clamp connections. |
| Medium： | ATCC® Medium 200: YM agar or YM broth ATCC® Medium 324: Malt extract agar ATCC® Medium 336: Potato dextrose agar (PDA) |
| Growth Conditions： | Temperature: 24°C to 26°C Atmosphere: Typical aerobic |
| Sequenced Data： |
D1D2 region of the 28S ribosomal RNA gene ATATCAATAAGCGGAGGAAAAGAAACTAACAAGGATTCCCCTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGTGGTCTTTGGCCATCCGAGTTGTAATCTAGAGAAGTGTTATCCGCGCTGGACCGTGTACAAGTCCCCTGGAATGGGGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAGGGCTTTGTGATGCACTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACGCTTGAAGTCAGTCRCGTCTGCCAGGGATCAACCTTACTTTTGTGAGGCGTACTTCCTGGTTGATGGGTCAGCATCAGTTTTGGTTGCTGGATAAAGGTCAGAGAAATGTGGCACCTTCGGGTGTGTTATAGTCTTTGATCAGATACAGTGGCTGGGACTGAGGAACTCAGCGCCGCAAGGCTGTCTTAGGATGCTGGCAAAATGGCTTTAATCGAC |
| Name of Depositor： | AT Martinez |
| Isolation： | Mycelium of fruiting body cap, Madrid, Spain |
| Cross References： | Nucleotide (GenBank) : AF007221 Pleurotus eryngii polyvalent peroxidase MnPL1 precursor (mnpl) Nucleotide (GenBank) : AF007222 Pleurotus eryngii polyvalent peroxidase MnPL2 precursor (mnpl) Nucleotide (GenBank) : AF007223 Pleurotus eryngii polyvalent peroxidase MnPL1 precursor (mnpl) Nucleotide (GenBank) : AF007224 Pleurotus eryngii polyvalent peroxidase MnPL2 precursor (mnpl) |
| References： | Guillen F, et al. Substrate specificity and properties of the aryl-alcohol oxidase from the ligninolytic fungus Pleurotus eryngii. Eur. J. Biochem. 209: 603-611, 1992. PubMed: 1425667 Ruiz-Duenas FJ, Martinez MJ. Enzymatic activities of Trametes versicolor and Pleurotus eryngii implicated in biocontrol of Fusarium oxysporum f. sp. lycopersici. Curr. Microbiol. 32: 151-155, 1996. Camarero S, et al. Preferential degradation of phenolic lignin units by two white rot fungi. Appl. Environ. Microbiol. 60: 4509-4516, 1994. PubMed: 7811086 Caramelo L, et al. A search for ligninolytic peroxidases in the fungus Pleurotus eryngii involving alpha-keto-gamma-thiomethylbutyric acid and lignin model dimers. Appl. Environ. Microbiol. 65: 916-922, 1999. PubMed: 10049842 Ruiz-Duenas FJ, et al. Regulation of peroxidase transcript levels in liquid cultures of the ligninolytic fungus Pleurotus eryngii. Appl. Environ. Microbiol. 65: 4458-4463, 1999. PubMed: 10508075 Ruiz-Duenas FJ, et al. In vitro activation, purification, and characterization of Escherichia coli expressed aryl-alcohol oxidase, a unique H(2)O(2)-producing enzyme. Protein Expr Purif 45: 191-199, 2006. PubMed: 16039872 Camarero S, et al. The cloning of a new peroxidase found in lignocellulose cultures of Pleurotus eryngii and sequence comparison with other fungal peroxidases. FEMS Microbiol Lett 191: 37-43, 2000. PubMed: 11004397 |