微信小陈
微信小章| 产品名称： | Cryptococcus neoformans (Sanfelice) Vuillemin |
|---|---|
| 商品货号： | TS210415 |
| Strain Designations： | CBS 132 CCRC 20528, DBVPG 6010, IFO 0608, NRRL Y-2534 |
| Alternate State： | Filobasidiella neoformans Kwon-Chung |
| Application： | control strain for identification Biomedical Research and Development Material Emerging infectious disease research |
| Biosafety Level： | 2
Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country. |
| Product Format： | freeze-dried |
| Storage Conditions： | Frozen: -80°C or colder Freeze-Dried: 2°C to 8°C Live Culture: See Propagation Section |
| Type Strain： | yes |
| Preceptrol®： | yes |
| Medium： | ATCC® Medium 200: YM agar or YM broth ATCC® Medium 28: Emmons modification of Sabourauds agar |
| Growth Conditions： | Temperature: 24°C to 26°C
Atmosphere: Typical aerobic |
| Sequenced Data： |
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence
GGTTTCCGTAGGTGAACCTGCGGAAGGATCAGTAGAGAATATTGGACTTTGGTCCATTTATCTACCCATCTACACCTGTGAACTGTTTATGTGCTTCGGCACGTTTTACACAAACTTCTAAATGTAATGAATGTAATCATATTATAACAATAATAAAACTTTCAACAACGGATCTCTTGGCTTCCACATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCAACTTGCGCCCTTTGGTATTCCGAAGGGCATGCCTGTTTGAGAGTCATGAAAATCTCAATCCCTCGGGTTTTATTACCTGTTGGACTTGGATTTGGGTGTTTGCCGCGACCTGCAAAGGACGTCGGCTCGCCTTAAATGTGTTAGTGGGAAGGTGATTACCTGTCAGCCCGGCGTAATAAGTTTCGCTGGGCCTATGGGGTAGTCTTCGGCTTGCTGATAACAACCATCTCTTTTTGTTTGACCTCAAATCAGGTAGGGCTAC D1D2 region of the 26S ribosomal RNA gene ATATCAATAAGCGGAGGAAAAGAAACTAACAAGGATTCCCTTAGTAACGGCGAGTGAACCGGGAAGAGCTCAAATTTGAAATCTGGCGTCCTCCGGGCGTCCGAGTTGTAATCTACAGAAACGTTTTCCGTGCTGGACCGTGTCTAAGTCCCTTGGAATAGGGTATCAAAGAGGGTGACAATCCCGTACTTGACACGATCACCAGTGCTCTGTGATACGTTTTCTACGAGTCGCGTTACTTGGGAGTGTAGCGCAAAATGGGTGGTAAACTCCATCTAAAGCTAAATATTGGTGGAAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACGATTGAAGTCAGTCGTGTCTATTGGGTTCAGCCAGTTCTGCTGGTGTATTCCCTTTAGACGGGTCAACATCAGTTCTGATCGGTGGATAAGGGCTGGAGGAATGTGGCACTCTTCGGGGTGTGTTATAGCCTCCTGTCGCATACACTGGTTGGGACTGAGGAATGCAGCTCGCCTTTATGGCCGGGGTTCGCCCACGTTCGAGCTTAGGATGTTGACAAAATGGCTTTAAACGAC |
| Name of Depositor： | CBS |
| Chain of Custody： | ATCC |
| Isolation： | Fermenting fruit juice |
| Cross References： | Nucleotide (GenBank) : EU240005 ITS including 5.8S rRNA gene Nucleotide (GenBank) : KU729166 D1/D2 region of 28S rRNA gene Nucleotide (GenBank) : AF075484 26S ribosomal RNA gene, partial sequence Nucleotide (GenBank) : AF218975 Filobasidiella neoformans var. neoformans strain TS210415T 5.8S |
| References： | Vanbreuseghem R, et al. Experiences with BAY b 5097. Mykosen 18: 199-211, 1975. PubMed: 1099443 Sanfelice F. Sullazione patogena dei blastomiceti. Ann. Ig. Sper. 5: 239-262, 1895. Fell JW, et al. Biodiversity and systematics of basidiomycetous yeasts as determined by large-subunit rDNA D1/D2 domain sequence analysis. Int. J. Syst. Evol. Microbiol. 50: 1351-1371, 2000. PubMed: 10843082 Meyer W. et al. Consensus multi-locus sequence typing scheme for Cryptococcus neoformans and Cryptococcus gattii. Med. Mycol. 47(6):561-570, 2009. PubMed: 19462334 Diaz MR, et al. Comparative analysis of the intergenic spacer regions and population structure of the species complex of the pathogenic yeast Cryptococcus neoformans. FEMS Yeast Res 5: 1129-1140, 2005. PubMed: 16061425 Scorzetti G, et al. Systematics of basidiomycetous yeasts: a comparison of large subunit D1/D2 and internal transcribed spacer rDNA regions. FEMS Yeast Res. 2: 495–517, 2002. PubMed: 12702266 Chen YC, et al. Polymorphic internal transcribed spacer region 1 DNA sequences identify medically important yeasts. J. Clin. Microbiol. 39: 4042-4051, 2001. PubMed: 11682528 Biswas SK, et al. Molecular phylogenetics of the genus Rhodotorula and related basidiomycetous yeasts inferred from the mitochondrial cytochrome b gene. Int. J. Syst. Evol. Microbiol. 51: 1191-1199, 2001. PubMed: 11411687 Sugita T, Ikeda R, Shinoda T. Diversity among strains of Cryptococcus neoformans var. gattii as revealed by a sequence analysis of multiple genes and a chemotype analysis of capsular polysaccharide. Microbiol Immunol 45: 757-768, 2001. PubMed: 11791669 Butler MI, Goodwin TJD, Poulter RTM. A nuclear-encoded intein in the fungal pathogen Cryptococcus neoformans. Yeast 18: 1365-1370, 2001. PubMed: 11746598 Chen YC, et al. Identification of medically important yeasts using PCR-based detection of DNA sequence polymorphisms in the internal transcribed spacer 2 region of the rRNA genes. J. Clin. Microbiol. 38: 2302-2310, 2000. PubMed: 10834993 Cogliati M, et al. Origin of Cryptococcus neoformans var. neoformans diploid strains. J Clin Microbiol 39: 3889-3894, 2001. PubMed: 11682503 |